Description :
Non Conding Region
Location :
Scaffold_1:28578- 29472
Sequence
894 bases(100 bases per row)
TTGCCAGCGAATTGCGATTCTGAGACAACGAGCGATTCTGGAGTCCGTATTACGGACGCAAAATGACGGGGAAAGTATGCAGTTCGAAGAAATGTCCGAA
AGCTTTCTGGCAGCAGGCGCAGCAAGGAGCTGCGGAGAGAGGAGCTGATGGAGTGATGGAGGCCCGGAACTGCTCACAAACGGCACGAAGCGGACCGTTG
ACTGGAGTCAGCGACCACGAATAGGTTGTCAGTTTTGGAGTGTCGAGACATCTGCTACGTGTGTGAGCAGCTTGGAAGGGAGACAATTGAGCAGCGCTGC
TGGTTGCAGCTCCGATGGCGTTGAAGCGATGGTGAGATTTTGTTATACGGTGGCGCGGTCGTTTTGCTGGCAAAGTCAGCGTGCTATTACTAATAGCCTA
TTAGGCGGACCTCTCTGGTGATTGGGATCGGCCAGGCCTGGACGCTCATTCATGAAGATCAAATTACAGTGCATTGTGTTCATCGCCTGGTGGAGTGCAA
GCGAGGTGCCATGATAGTAGCTAGAAGGACGCTGCGAGAGGTTTGCTGCACTTGCTTGCGTCACGCGTGACGCGAGTGCAGCCATCGCTGCTAAGCTTTT
TTAGATAGCTGAGCCTCGAGAACTTTATGGCAAAAGCTGCATGTCATGCGCCTTTCGAGTGCGGCGCTGGTAGATCTGTCACCTTGGCGCGGCACTGGGT
CGCGTGCGCTCACTCGAGCATGACACGCTCAACATTGTCGAGACTCGTTGCCTTTTCCAGTAGCCAAAACTTCAAGTTTCGTACACGCATTTTTGTAGGG
ATCGGACCAGACATCGCCGGTGCTTTGTTACCCCGTTAGAGTGTCACTTTAGTGACTACAGCTTGACAGCCGCTCATATCCATCACACGATTCC