Description :
Non Conding Region
Location :
Scaffold_1:28313- 28375
Sequence
62 bases(100 bases per row)
ACTATTTCAACTATTTAATGACAACGCACACTACTATCAACCACCGCAGTGGACAATATAAC