Description :
Non Conding Region
Location :
scaffold_1:28296- 29850
Sequence
1554 bases(100 bases per row)
GGCCTCACTTTTTGACGATGGCCCAAACTTTGGACTCCAAAGATGTGAATGCAAATATTCACAAACTACTACAATATTGTATTGCGAAATTTAGGAAACG
AAGAGGCACGAAACGACAGTGCAGGGTTTTACAGTTGCAGTCCCGCCATGACCAAGGCATCCAGACACTTGCTGTCGAGAAAGTGCGATGGTAACCAGGA
AGATGCACACAAGCCAGAACCCAGCAGTCGATCTCCAAAACTTCACTTTCCTCTACAGCAGCAGCATTCTCCAGACTGGGACGATGGCGCAGAGAAGTCC
GTGGAAACCAAGCGCAGACCGACGGCGCTCGAACAATTACTAGACTTGGAATTAGACTTAATCCTCCCTACGACTGCAATTCCAGCTTCGAAAAATAACC
AGCTACCAGCTTCTGTAGCAAGGGACCAGCAGCTCGAGACGGACGTCGACTCGGTTTCGTTGGAGCTCCTTGTAAGTGCATTTCTACAAATTTAATCGGC
AATTGCTCACCTTTGTGTGCATGTGACGCGATAGGCAATGCAGAGCCCACATGGTGAAAATCAGCAGTGGCAACACGAGGAAGAGGAATCCGTGCAAACC
GAAGCACCAATTCGACCGGAGCATTCTCCACAACGCACGAGGAAAGAGGTATCGGCCGCTAGAAAGCCGATATCACTGAATATCGTGTCACCATCAGCGT
TCGTTCCAGCATTCCCAGCCTCACCAACCCAGACATCTACAGATGATGACTACGGCTTAGCTTCTCCCATGGCTCTACCAGACACACCTTCGCAGACTCG
ACCAGAGATTGCTCTAGCCTGGGATCTCGAGCCGACCTCTCCAAAATTTGAAGAAGTATCCTCAAAAGCAGAAACTTTTCGTCGTCTTGCTCAATCCAAG
AGCGTCCAAAGACCAGAACGTCGAGCCTCGTCAGCTTCGTTTACTGCTAAAGCTACAACACCAAATCCTAGAAACTACAGAAATTTCGTACCTGACAGAG
CTGCGTCGAGAATAACGAGGTCATCGCTCCCAACATTACCAGAAGTTCGCGGCAAGGCTAGGCATGGTGGAATTTACTCGCTGCTACTAAAAAATAAGCC
GGTGAAACAGGAACCAGTTCTCGTAGAAGATGGACACAGCCCCGAAGGTAAGCTTCCACGCGGATACCATGTGTAGTTGGCAACTTGAACGATAACATGT
ATTGATATGTGCCCCTTTAGAGATGGTGGCAGCACGATCGATATCCAAGGTATGTGCGTAGGAATATGTACAATTGGCATGAAGACAAAACTGAGTGTAG
TTCCTGTTTGCTAGAGTTCACCCCCTCGCACGTTCGGTGAGCAAAAGCATGGAGGGATTTACAAAATGCTTCGAACTAGCCAGGGACCTCATTAATTTCT
TCATAATATTGAGATCGACTGCAAAATTCCTTGGTAACGTTTGGTATCCGAAATCGAGTGGATTTTTATCTGTCATACTGAAAAGATAATATTTGTCTCA
AAATAATAGTTTCCTTTGGAAATACACATTTTGCGCATCTGTCACAGTCAAGAA