Description :
Non Conding Region
Location :
Scaffold_1:28274- 28588
Sequence
314 bases(100 bases per row)
CATAGAATAATGAAGCTCGAGATATGTGTACCTACATCAATTCCAAACTACGAAAGTGTTGTGAACGATACACAACATAGATAAGTATGCTTCACTTGTC
TTTTGGCATCCGTCAATTCAATCAACAAACTCGAATTTAAAGCGCCATAATGAATATGGTGCCTTATTTGCTCGAAGATGTCTTCTATTTCTTGATGTAT
ATAATGTCGCTGTGACGCCTATAGGATTTATTGAGAAGATCCCGACAGTTTTCAACGCGTGCTCCATATCTCCTCGGCTTTGTGGGCGGTCAGATGAGTT
GACATCAAGGGATT