Description :
Non Conding Region
Location :
Scaffold_1:27799- 28116
Sequence
317 bases(100 bases per row)
AATCACCACTGAGCTCATTTCCATCATTTCATCGTCTGCGTAGCTTATCTATTTTCGCTATTTATGACTCTCCAATATACCTCACCTTCAGCGTTCCATC
GTGGCACTTCCTCGGACCCTTCAACTCAGTGTGCGCTCTACCTTGGAGCAAATGAACGAGATCTCCCGCATGGCATCCAAAAGaCGGGAAATCAAACACA
CGTCACACGTTCAACTCGAGCTCGAAGCGTTGCATCGGTTCTTCCAGAAAACaGGAGGGgATCGAGGTTGCTGGCATGTGGACGAAGGCTGGACAGCACT
TTCAAACGCCGTGAAAA