Description :
Non Conding Region
Location :
scaffold_1:27764- 27835
Sequence
71 bases(100 bases per row)
GGATACGTTGGCCTCATGTGGAAAGGTCCCGTTTGGAGATCGTATCACCCCATCGCTAACTTCGACGTTAA