Description :
Non Conding Region
Location :
Scaffold_1:27616- 27988
Sequence
372 bases(100 bases per row)
GGTTGAAGTAGGCAGTGATTGTGTGTGTGTTTTAGGAAGCAGGCAGAGTTGGTCCCCATGGACGCTGCAATTTACTCTTCATAATTTTTGCATTGATAAT
GGGAAACGTTGTTCGAAGAGAGGCAACGAAACCCGACAAGCACAAACTCGCGTTTGAGCGTATCCGAAAGTCGATAAAAACAGAGCGAAAGAGCCTCCTC
GCCTCTTGAACGTAACCTCAAATCCATTGAAGTGTGTGGAGTAGTGGAGGAGCAGCATCGCGGGCTACCTCATGTTCTCTCCAAAGTGCTCCACTTGTCA
GCTAACTCCTTTTTTCCTCCTTCTGCAAAACAAGAAGGGTAACTACAAAACAATAGCGCTACGTGTTTACTC