Description :
Non Conding Region
Location :
Scaffold_1:276- 610
Sequence
334 bases(100 bases per row)
TCTTGGAGAGATTTGAACCAGAGGGTGGTGTATAAGGCGTTAATCATACCGACATTGATCGCATTCAGTAGAAGCAGACTTGCTTTTGGGTTTCAGTGCA
GTTGTCTTGCCACGCACGATCTCCTTTGTATTCCTCTTTGCCAAACACTGGTCTCTTGATCACGTACTTCTTCCGGAGCATGAGCGTTCCATACTAAGAG
GAGCCGAGACTCATTAAAAACCAACCCATTTTGAATCTCCTTTCATCAGAACCNNNNNNNNNNCAACACTGGGCTCTTGATCACGTACTTCATAGCGTTC
CCTGCGACTCATTCCATTCTGAATCTCCTTTCAT