Description :
Non Conding Region
Location :
Scaffold_1:27525- 27688
Sequence
163 bases(100 bases per row)
ATTTTGGTGTTGTGATGTCCTGCAAAGTGAGAAGTTGGGCGTTGAGATTTGACATATTTGGAGTTTTCTTTTTGAAGTTGACAGAAATGGACCCACACCG
GAGCATGCGGGCAAGGAGTGGCAATCGTCATTTCAGCAAATTCGTCTAAACATATGCAGTTTG