Description :
Non Conding Region
Location :
Scaffold_1:27459- 27512
Sequence
53 bases(100 bases per row)
TGAGCTGTAAATCAAAAGTCGCAGCAATAAACTTAAAAGATTTGATTGCACCT