Description :
Non Conding Region
Location :
scaffold_1:27241- 27478
Sequence
237 bases(100 bases per row)
TTACGGTTTGGTTTGGAAGTGCAAAAAAGTATGGAAAGCACTATTGTACCTCCACTTTCGAATGATATTCGAAAATAGAGGTAGAACGGCAACTTCAACG
CCAATACAAAATAAGGGACGGAATGGCGAATGTTCGTTAGTTGATTCTGTCCTGCATATCCTTGGCTGATTGATTGACAGCGGAGCTCCACGTGCACGCG
GTACGCTAGTTCTATTAATCTCCGACCTTTACGCCAC