Description :
Non Conding Region
Location :
Scaffold_1:27004- 27983
Sequence
979 bases(100 bases per row)
GCGTCTGCGTGCTCATCGTGAACCATCGACTCGAGCTTGCTCAGGCGCCGGCGCGCCGTCTTGGCTCGGTGCCGGCGCCAGGACGGGCCGTGCGATGTGG
TGGGCGGTGCCACAAACAAGGGCGCGAGCGAGACAGGCGTGTCAAGGTAGACGTCGTAGGCTTCTTCATCATCGTCGTCGTCGTCGTCGTCGGACTTGGA
AGGAAGCTGCACCGAGGGCGGCGGCGACGACCGCCAATACTGGAAGAGCTGGCCCAGCATCTTGAAGTGCAGTAGAGGATTCGAGTTGGAGCTGCGGTGA
AAACGAGCCAATCCGAAGCGTTCTTGACAGCGATTGGAGCATTCTCGCCATCATTTCGGATTTTCTCTGCGCAACGATTGGGTAGCGACCTCTGTGCACT
CGATGATTGGCTTAAATAGATTTGCAGCGCCTCTGTCAATGACATGGCCGTTGAAGCCCTCGAGTAGCCACGGACCAGTGAGTCGGACGATCTCGCTTGT
TGAAGAAAACGCCAGACGTGCGTGCGTGTCAAGGTGCAGCTAGATTCGGGCGCCGTTGTGTCGATAGCTCTACCGGAATGATCGTTCATCGGAAGCGCAT
GCTGCGTTGGACACAGCCCGTTTCTACCGAGGAACGTCGGTGATGCAACGCACATGTGGCGAACCAGCTTCATGTATGGGCTTGAAGCGTCGTCGTGGTG
GACTCTACTGCGGACCATGGCTGGTCTCAGAGCAGGGCCGCAATATCTCGTGCATGTCTAAATATGATCAAGGCGCTGCTCGCCCAGATGCCGAGTGCGG
AAAACCTGCGTCTGCGAAAGAAGGTTCCGTGCGCTAGCCAATCCGAGCTCCAAAGACACAAGGAAATGCCGAGCCAAACAAACGCCTCTTTGGCTGCAGT
ATAGCCGGGTACCAGATATCCAGTGCACTACGTTCCAGAACGCATAACCAGTTGCAACCGAATGTGCTACTCGACGAAA