Description :
Non Conding Region
Location :
scaffold_1:26789- 31168
Sequence
4379 bases(100 bases per row)
GCAGTTGACTTGTCGCCAAAGTGAGGGGCATTGGGCGACGGCGTCGACACGTCAATTAGTGCCTGTGTCTTTGCAGGGGTGATTTTCAGGTCGTCTTTAG
GTTTGCTACGCCTGGGTTCTTTTCGTGTGCGGTCCATCGCAGAGCTAATCCTTACCACTGCGAAAACACCTTTGGAGACGGACTGCAAAAAACAAAGTGG
AGAACGGAGGTGTCGAACCGAAGGTGGTATTTGACACTGCATTCGCCATCCCAGCGGTGTTTGCCGAAGGGGACGCGATGGTGAGCAAGTAGGGAAGGCG
GCATGTTCTGTATGTAATTTGGACAACTAGAAACGCGCAGTAGGGCTATCCTCCAAGCAAACCCTCAACAATGGCGGCGGGTCTGCGCAGCGCGAATCGA
TCCTCTACCTGCGTTTGCACGGAAACGCTTGCCACCTCAGACAGATACCCAGAGGCGTCCATTTTCGCTTCCATGAAAAGCAGCTCATAGGACCTAAAAG
GGCTAGTAGTTCATCAAAGCTAAATTCGCAATTCCGAGTTATTCTGCAGCCACCTTACCACCAGCATTACGTCTGGAATGCGCTAGTCTTACATAACTTT
GACCGCACCGCGTATGGCTGGTGCCCTATTGAGAATTGTGAGCAACAACATTGTCCCTGTTGAACGATTCAACTTGGATCATGACAATATGGCCCCAAGA
ACAGTAGTAACGCGTTTACTTCCCGCGTCGCTTTCTTGGTGAGCCACAAAGCGGGCAATCACGGGATTGTCAATGGCCGTACGATAGATAGCACGTCGAA
GCGCGCATGAATTCTTCGAAGCCAACTCGGCGACAAGAACTCGTGCAGTTCGCGTTAAACCACAGAAATACGCGAGGATCAGCATTTCGGCTCCTTTTCT
TGGCTTTCCTCAAGCACAGCCGAAGATGCCCATGTAAAGATGTCCGAGCGCGTTTCTAGTGTCGCTGTCGTTAAGCGCTTTCGGGTCGACGCACCGTCAG
TAAAGGTGCCTTTAGGTCGCCTTGCCGAAACAATGCACGAATTCCCGATCTGTCAGTCTTCGAACGCAAGCCATGATGCCGCGCCTTGAGTGTGAACGTC
GGAATTTGCGATACCCAAACACTCAAGGCGAAACATCACGAGGCGCAAAGCGACGTACTGTCGGAAGTACAGTTGGACCGATCAGTGTATCTTGAGACCA
TTTCGGTGAGATTGAAGCTGGTGAATGGCTAGTGCTAGACAAGCTGGAGCTTGATTGCTAGTTGTGAGGTGCTATAAAGTTTACACACTACACGGGCATG
TGGTTCCGAAGAAACGTTAGTACAAGGAAGCCTGCTGGAGGTTACCCGGATCGTCCGGTAAACATTTGCCAATTGCACACTGACCCCAATGGATCACGGG
AAAGACCCCCAGTGCGGTGGAAGATGTCACGCATGATGTTCTATGATCAGACTAATGACGAAGTGCTATGCGCTTGCTACCGGTAGTCGATTGATGAACC
AACGATCGAAATATCGCTCACCTCGCTTTCCTAACAAACACGATTGGCATTAGTATTTTCAAAACAACGAAGCATTCAAGTTGCAGCTCACATGCGTTAA
GCAACCACGTAGTAGCTTACTTTGAAGGGGCTGCAACTCTTTGGTCGCGTCGACAAGCTTCTAGCACGATCGGGTGACAGAGAGCGAGGTGGCAACCAAA
ATCCATTACCATGCTGGTGTGGTGGGATGTAAGTAAGGTTCCTTCGACAATCGCCATCGCGCCAACCTCTTGGTGACGCACAGCTATTACAGGATGACAC
ACCAGGATCAAAGCTGGTCGCGAATTTCTCGCTACTGCACGCGCAACTTTGCTCTTCATCTCCCTCTTCTTCATCTTCTTGAAGTGTGAGCTCGTGAATC
GTAAGAGCTTGCTCTTCAAGCCGCTTCTTCAGCTTTTGTCGCTCTAGCTGTAGCTCTTTGATTTCGCGCAACAGCTCGTTTTCGCTCTTCTCTCCAGTTT
GCCAACACACTTTTTCATCACGGAATCGAGCTTTCAGTTGTGCTACTTCTTCTCGTAATACTTCACACTCCTGGCGCAAACTAGCAACCAGACCTGTGTG
TTGGGACGAAGAAAAATTGTCTTCTGCACCTGCAAACAACATAGATGCAGAGCGCGAATCAACTTCGGCTGAACCTGGCGCCAAGTTTGCCTTTGAAGGG
GAGACGTAGGTGCCGCTAGTCTTTGCTTGGAGTAAATCATCTATTGTGTGAGCCTGTTCCTGCAGACCCGATGAGTTGCAATTATCACTAACCTCCTTGG
CAGATTTTAAAACGTACCTCAATCAGTAGGTTGGCACTCAACTGTGCCTGTACAATCTCGTTGTAGTGCTTTGATTTTTCCTGTTTGAGCAGCTCATATT
GTACTACAAACTCTTCGAAACGTTTCGTGAGTTGCTCGTGATCTTGCGAAATAGATTGCTTATCCGCTTCGAGTCTGCGAATTTGATCGGTCAAACTTTC
ACGCTGTGAAAAATATAGGAGGACTGAGATTATAGTTCACATCACTCGCCATGTTTAAACACCATACCTCTTCCAGACGAGCACCTTCAAGTTCCTGAAG
CTTCCTGCTTTGATCTGCTGTCTGCTCATTCACGTACAGTTAGCTTAATTCTTGATTACACGACGAGTACGTTTTCAATATTGCTTACCACTGCAGTCAA
ACTCGTCAAGTTCTCTACCAAGTCTTGCATCGTTTTTTTCGTCTCTTCCACTTGCTGAGACTCTTCCTCCCGCTTTGCTTTCATATCTTGTGCCTCCGAT
TGAGCTTCCTTTAGCATACTCGATAATCTTTGCTCTGTTTCTTTAAGTTCGTGGTGTTGGTTTACCACAGCCTTGCATTTACCTCGAAGCACCTCACATT
CCTCGACAGCATTTTGCAATTGTTTGCAGGTGTCTAAGTACTTGGAGTTTATTTCTTGAAAGCGATCCCAGCGCTCAAGCTCCAAAGTTTTTGTAACTTC
GAGTCGAGTTTGTTCACGAACTGCTTCCAATTTGATTATCTCATCTTGTTGCTTCTGCTCAGGGGTCTTCAAACAATGTGTGCAGGTAGCGCTGATCTTC
TTATGCTTCTTTTCGATTTCCCAGCATTCCTGCTCCTTCGCCTTCATTGCCTGTTCATGCCGCACCTTCATTTGCTTCATAGTCTGGTTTATCTGCTCGT
TTTGTTGTTCAATACACGTGCGTGAACGGAATAAGCCATTATAGTCTTCTTGTAGCATCATGAGCTGCTCTTTCGAGTGTTGATGGTTCCTCAGAACTTC
TCGCCATTTGTCCTTCATATGTCGAATCATCAACGAATGTTCAGCCTTTAGTTCACTTTTCTCGTGCAGTGCCTCCTGTAGTGCCGTCGTCAGGTCCGTC
ACCTTCCGCTTATACATAATCACCTCACCTCCCATTTTCTCCTTTAACTGGAAACTGGAGCGCTCACGGTAGCGTGCATCCTGAAGCTCCTTGTCAACAA
GCTGCAACCGCGTTTTACACTTTTGCAATTCGTCCACCATTGGGCGGTGTACATTTTCCCATTCTTTTCGCTCATTCTCTAGCTTCCCTCTCAAGTGTTC
CACTCGAGCACGTAGGGCCTGACGTTCCTCTTGAGTAGCTCGAACGTTTGAAGCCGCCTCATTCTTCACCAATTCGATCGTCTCCTCATGTTTCTTCTCT
ACTGTGCGCAGCTTCTCGCTAAGACGGCTACACTTTGTCTGATCCTCTTGTCGTTGATCTAATGCCGTCTCTAGCAGTGAACTTGTGTGTGTGAACTGTT
GTTGGAATTTTGTCCGTTCGGCTTCTACAGCTGCCATTGCTGTTTGTAGTGTAGCGATTTCGCGCTTGAGTTGAATCGTGTGCGCACTTGCTGCTGCTGC
CGCGCGTGCCGCACTTTGGTCCTTTTTCACTAACTGCTGTCTTAACGTCTCGAGATCATGCAGAAATGAACGACGCTCCTGTACGAAACAAGTGTTATGC
GCATTGCAAATGGCTACATTCGTCTACAGACAACTTCAACATAAGCCAATCGTACCTTATCGAAACATCGCTGAGCGTCCTTCAAGGACAATGTCGAGGC
CGCGACCATGGCTTCCTTTGCCATGTTCGACGGAAGAGGTGGCACTCGGTGCCCTGCAGACACGCACCGTGCGCGGTATACACAAGCAGGCAGCTAATCC
TGGCCAAACTTCCCTACTACCTCTATGAATAGATATCCTCTTTTCAAATGAACATCAATCTGATGTTACACAGACTAATTAAACTGTCAATAACAATATC
CTTGTAGATCTTGTGGAAACAGTACTGTCGGTTTTACAACGGCGCATGTGTGGTGCACATCAGGTACAGACGTCGACAA