Description :
Non Conding Region
Location :
Scaffold_1:26729- 27140
Sequence
411 bases(100 bases per row)
CGATGGCTACTTTTCGAAGGATGTCGGTCGTTACGGTGCGCCACACGTCGCAGCTTGGCGCATTGCAGATCAAGCGTCGCTGCTGCACCGTTAGAAACTC
CCAGGTTTTCGTCACCTTTTTTGTTTTGATATACGTAAGCCAAATGTGTGCGTTTTTGTATGCAATGTGGCATAAATACGCATATTTGTTAACATCACTT
CAGCCGCCTTGGCAGATCCGCCGAGTAAAGTTGCGCGACGCCGCACCTCAGCCACCGAACATTTCCATTCACCCATCACAAAGCGTTCCCGTCGGACCTG
CAGCGCTTAGGCGGTCGCCGGACGCGCTCGCTGGCGATCGCGCTCCTATCCCGCCACTCTCGGATTTGCCCCGCGCGGCATGCACTGCAGCTGACGGCCA
CATTTCCAGAA