Description :
Non Conding Region
Location :
Scaffold_1:26638- 27154
Sequence
516 bases(100 bases per row)
TGTATTGCTATCTCTTCGTTCTCGGTTGtGTCGTGCGCTAGATGGATATGATATGACAAATACATGGTCATTTTTGGATGCGGTGCCGTTGCAGGCACCA
GACACTAGCCGCTTCTAATACACTCACGTTTCTCGACTCCTATTCTCTGCTCTGTAGCGTCCCATGCACTAGGAGAAATCGCTGTGTCTCGTGTGCTTTG
ACACCGACTAGAGCTATGGAGGAACGTTCTCGCACGCGGGATCTTCTGTATGCGATCGACAGACTGCGGACGCGAACGAAAATGCGTCCAGAGCATCACT
GGATGGCACGTGGGCATGTGCGGACAGCGGCGATTGGCGCATGAGCCGTGGGGCCTCAGCAATGCCACCCCCACGCCGAGACACCATCGCGCCCGTGCGA
CACTCACTCCCCACGGATCGCAGCCGTTCTCGATCTCATCGACCGCATGAACGTCACTTCGGAAAAGTCTCACGAGCAAAGGTGCCTCTCGTCCCTTTGG
GCCGCCGTCTGAGCGA