Description :
Non Conding Region
Location :
Scaffold_1:26629- 27358
Sequence
729 bases(100 bases per row)
TGCACTTCGCCCCAGTGTAGACAGAGAGACATTCATCGCGAAAGCAGCGATGCAGTAGTAAACCACTCGCTCCCATTCGGTCGAGTACCATAGATATCCA
TAGATGTACGTACATGCTGAAAATCCTTCACTACTCGTGACTCACCACTTCACAGCGACAGATGCTTGGTAGCTCCATTGCGTTGTGCCCGTCAACCATC
TTGGTGTTCATGTACTGGCACCCGTACGTGATCTTTTACCCCAGCTTCATCATGGTTTGTTCGCTACGGCCTAGCGGCTAGGAGAGCTCGGGAGCCCACA
GGTCGAGTCAAGTGCGTGGATCGACGACTGAAGATGAGTGCGAGCTTTCGCTTGGCGCGGCGGGCAAGTGTGCCGATTAGGTGCGGAGACGTCGAGCATG
CTTGCATGGCGGCGGCATGGAGAAGTTGACGCCGCAGGACAAATCCTTCAGCCGCGACTATCATGTCATCCAGGAAGTGCTCGCATCGCTCTTGGACCAG
GAACGTAGCGGCCATCTGTCTTACTCGCATCTCCACCTCCGTGCGCGGCCAACTCTCAACTCGAGGCTGTGCGGCACACGCGCACTTCTCGAATTGCTTG
ACCTCTGCAATGTCCTCTACAGGCTCGAGCCAACCGTAAGGTTCCCTCCTCCTTTCGATTGCATTACCGGTACCACCAGCGCCAAATATCCCTGACTCAT
TGTCATTTTGAACTGTACCAGGGCCGACA