Description :
Non Conding Region
Location :
Scaffold_1:26335- 27730
Sequence
1395 bases(100 bases per row)
TTGCTTCTGCTGGCTGGTGCTGATCTGTGAGTGTGAGTGGGGAGAACGCGGATCCTCGTGCGTGTTGCTGGGATCCGAAAGGGCGCTTGTTGCGAGATGC
TGGGGGGGGGCGAAACGGACAATCAATAGTGCGTGAGGCGTATTAATTCTTCTTCTCCTCTCTCCGTGGTGTCACAGCCCCACCAGCGCACAATCGCGAG
TGGCGCCATGACAGCGAGGGCACCTGCATGGACATGATCTGCTGGGCATCATTGTGTTGCTCTTTTCTCAAACACGCGACCTGACTGGGCTGATCACAGA
AACAAACAACAACAGAGAACTGTATCGGACATACTGAGATCAAGTCATAATTACATAACCGGGCCACTCTCGCTCCGCGATCGGAAAAGAGCGGGGCAAC
CAGAATTGCGACAATCGACAAAACATGCGACAAAATGATCCGAAATGATGGACAAGGGCGCGCCAGTCATCTGATCGAATCGATTTGGCCAGCACGAGCT
CTGTTTAGCTGCGCTTTTCTGAGACTCATTGTGTGCCTTTGGATGCTCGGAGCATTGCTCGTTGGGCAAGAAGGATGCGAGTTGAGCGGATCCTCTCGAC
TCGTGGAGGATCCGCTCGAATGGTCACCATGAATCAGGATGAACTGCTTGCTTCCTGCGCTACTCTTGTGGCTCCAGCGCCTGCTTCGAGTGCGCAACAT
ACACACAACCACTGGCCCAAAGACGTCTTGAGCTAGCGCTTGGCGGTCTCTGTGCACGAGTGCTCATGTTTCGAAAATGTGATCGAGTTCAACAAGGAGG
TCACGCACGAAGACTCGATCGGGTGCATCTGTGCGTACCGGTATACTTGATTGCTGTATGTGGCTCCAGTACGCGTCGGGCACAGTTGTACTGGACGCCC
AGCAGCTTGACCCACATCGTGCTCATGTACCATGGTGACGTGATGATCTCCAGGTACGTCGGCAGGTTGACGGGCGGGACACTTTCGCCCCCACCCTTCC
ATTTCGTCGCCTAGATATACAGTAATACGTCTTATAGGAGACTTACGACAGAAAAACTGCACAAAGCGCACAAATTTAGATAGCCCTTAAATAGGATATC
ACACATAATCTGCATTTTGACTGCGAACAGAAGAAGAAAGACGAGTTGACGCCAATTTTTGAAAATGTGGGAAGAAAAACACACATACTTTGATCGTAGG
AGCAACTACTCCCAATATCTATAATCCCAGCTATGACCTTCACTGGACTTGTGCACTTCATGTACAGCTCCCAGTTTTTTTACACGCTAGAAAACGAATT
CATATTTTGTGTTTNNNNNNNNNNTATCCGCCAAGAGGCGATCGAGAACCTGCGACGAAAGCTCGAGAAAGAAGGCGCCGCAAGCCCCACTGCCA