Description :
Non Conding Region
Location :
Scaffold_1:25882- 26905
Sequence
1023 bases(100 bases per row)
ACACGCCCACAATGTCTTTTCACAAGAGATCACAAACAGTAAGTTTATGCATAAAAATATGCATGGCACTGGTCACAGTGAAACCTTACCGGCAATGGTG
CTTTCGCTTCATGAGGGAAAACCCACTCGAGCACACAACACACGACTTCACCTGGCTGTCGTCTTCCCAGTCGACATCAAAGAGCTCTTCGCTGCCTTTG
CGGCGCGCCTTCCTTGCGTTTCTGCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGGCGACGCCATCACTCTGCTCGCGTCGATTTC
TCGGTTTACTCATCGAGTTTCTTCCTGGAGCTGTCGCAGAAGAAAGTCGAGCGCGGCCGCCGGCATCGGACCGGGAGTACGTCGTGCTTGGGACGCTCGA
CGCGGGGCTCACCGGGTAGCTATNNNNNNNNNNGCCGTGGTCCTCCATGCTGTTGCGCGTAGGCAGCGGCTGTGCGCTGGAAGTGGGCGGAGGGTACGGG
CCGCTGATGCTTGCGTTTGTCGACGCTGGTTCCGTGCGCTTGACGGCCGGATGGCCGTACAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAAAGT
CGCCGTCGTCGTCCTGCCACAGATAGAATGGACAGACGCGTGGGCGCGTATGTATAGACAAAGAGTCTGTTAGTAAGCCACATAGACGACATATACAGAG
ATGCACATACAGAGAGACACGCACCTCGTCGAAGAACGGATCCGCCATATTTCTTTCTGAATATTCTCGTCTCTCTTTTCTATTTGAAGTGTTATAGGAA
CACAAATAAGAGCGACTTCGATCCAGATTACCAACACTGTGTTCCACCACACGTCTCACAATAGGGTTCCACATATCGCTATACAATGTAATGTCGAGCG
ACTCACATATTATCCTACCTTGAAATGTGAAATATACTTTGGGTCGCTCCACATTGTTTCTTGATTCGATTTTGAAGACCCTGCAGAAAACGTGCGGGGC
GATTGATATGCATGCGCTGCGCA