Description :
Non Conding Region
Location :
Scaffold_1:25802- 26925
Sequence
1123 bases(100 bases per row)
ATGTTGCGCTCATGGAGATTGTGAATAGGCTTTGACGCCTTCACATCTGACGGGTTAACAAATCAGATACTACCTAATAAGAGCTTCGGTTCAAACTACA
TGCAACACACTGACGTTGACGTCTGCAGCAACGTTGTCTCTACTAACAAAACTGCAAACGTGCACACTTCTACTTGTAGCTATCAGGTTACTGTTGCCAG
CTTTTAGCTTTTAGATCTTGCTGCAAGATTCTTGCAGAAGGCACGGATGCAGTCCCTACTTCGAAGTTTGCTAACCTCTTCTCACTTCCTCATGAAAATC
TTTGACCCCGTTGTGTTCATTGCAGTTTCTGCTGTTGCAGAGGAGACCAATACCCCTTGATGAATCGTATACCGATGTCATCACCGAAGGTGGCAACGTC
GTTCTGTACAACGGAGGTGATACGCCCACGCAGTAGAACCGTGAGGAGGACTGCATATCCAGAGATCAACTTCACCAAGATTATGGACTACAGCAAATAC
CACGACGTGCAGGTCGAAAATCAATCCGACATGCTTGTGCCAGACGTCCAGACTTCAATCGGTGGACAAAGGAGGACAAGTTGCCTCGCAACAAGCCGAA
GGGATTGTCCGAGGCTTACGATGCGCTCAAGGATGGCAGCGCTGCTTGGATGGCGGGTTCGAGTACGACGCTAGCACTCTAAGCGGAACTGCTGCGCCTT
TTACCCAGCCGATCTGACGAACCTTCAGTGGACCGGCAAGATCCTTCGTCCTACCCGCGCGACGACGACGCTGTACACTGGCGACGTGAGAAGTACGCTG
ATCCCGTGACATTTGTCGGCGGTAACGGCACGAATGTAGTGGCGGCCTGGGACAGGTTGCCTTCAGCAGACACTTCGCACGGTCGTTACCAACGACATGA
AGAAGCATGAGAGAGGGGCGAACTCTCTGAGCAATTGTATATTGCATAGAAAGGAGGCATATAGCAAAGCGAAACTAACAGAAACCACTGCGGCTCGTGC
CGCAGCGGCTGCATTGAATACCAGAATTCATTTCACCTCCAAGCAAGGATTCTCAAGCAAGCCAAGGGTCGAAAGACACTACAAAGTTAACTTTAGCTGT
GGACAACGATCCAACACGGGCCA