Description :
Non Conding Region
Location :
Scaffold_1:25773- 35785
Sequence
10012 bases(100 bases per row)
CTCTGCTGGAGGTGCTCTAGCAGAGCATTCTCATAGCTCGAGACGCGCGTTCACCGCGTCGGGGCCTTGCTGCGCAAGTTGCGTCACGCCCTCCGGGCCC
AGCAAGGACATAAGCTTATTAAGCGCATCCTGCTGGTTCGGGGGCAAGTGAGCGAGCTGCTCCATTCTCCACAGAGGGTCAGTCTATACAGACTCAGGTG
TCGGATTGACTACAAGTGCTACCAAGTGCACCAAGTGCAGTGGGGCTGCCGTAGCTTTGCGTCGGAGGAAGCTTAACAGACTCGCAGAGTCTCAGCTTAA
GATCGCCCGTTCTAATACCAGAACGTACGAGTCCGTACAACTTACGGACTCCAAGAGTCAACCCTTAACTCTTAACTGTGTGAATCTCAAACTGAATGTA
TTTCCCTTTATTGCGGCAAAGCCGCCTACTGTGTAAATGTATCCGGTTCACTATCTAGCATAGTGAATCCTAGTCATAATCAGTGGCTCTGAAGCCATGT
ACTGATTATCCTACTGATTTAGGTTAGACAGTGTGTACCCACTTCATAACCCTTCGGGTAACTCTCGTGTAACCCCGTTACAATTTTTGTTGTTGCGTGC
AGCCGTTTTCATATGAAGTGTTAGCGTGGTACCATACTGTATTGCGTCGGTACCGGTGATCTCCGATAATAAAAAATAGGCATAAAACCAATTATATATT
GGATCACATTTTGGACCACTGCTACCAGCTCATTCAACATGACGGAAAAGCAAGCGGAAGCCGAGCGAAAATCTGCGTGCGTTGAGTCGGATCGAGGCGA
GTGGATTTGTGGGAACCATGCTGTACGTGTACGTTACATATGCATACAGTATGTATGACGCTAAGTTAGCTGGCGTTTACTGTATACAGTGCTCGCCCAG
AATGTGAAATCTCCTTGTCTCTGAACTTCAGAGTCTGAAGAACCGTGCTTCTCTAAACCATATGACACTTACAAATCAACTAAACGCGTAAAGGCCGGCA
GTACAGGTATTACTGTACAGCACAACCAGGGAGTGCGCTTTCAGACATTGAAAGTCCGTCTGTGTTACCCCCTTTTGATAGAGGAATTGTGCCACACAAT
ACATATCTGACACATCGAGAGGGAGATCTCTACAGTACAGTATAATTGCTCAAGATCTTTCCCACTGCTTCGGAGAGGAGCGTGCACTGACAGTATGTAA
CTACATGTAATGCAGGAGGAAACATAAATGGTATCCTAAGAATCTTGAAAACTCGACGATGCGTTGAGCTGTCGACTAACACCCAGAACAGCTGTGTGTA
AGGGATGGACTCCAGCGCAGATGCTGTTTACCAGCAGGTGTGCATATTATGTATTCGACTCTATTATTAATATTTCGAAGTATACTTTTGATTTAAGCAC
CAGTGCATAAGTCCACATTGTAGTCAAACATAACATCAAAAGCTGACTTGCCACTACTCCCTCGGCACCAGAAGAGCTATGTACTACAGTAGCAGGTCAT
ATCTTGTCCGCAGTGATATTGCATACACTAGTATAGCAGCATCCTCACGGCGAATTTTCGCCCCGGTTGCTAGAGGGGCATTGCTTCGGAAAATGTTGAT
TTTAGCTTCTCCGCACCGCCCCCAAGTATCCTATACACACTCATACTTTTACCAAATTGGTTTCAAAAATATATGCACGAAGTGGCGGATTTGCATCAGA
TTTTATTAAAATGACCGGGCTTGGAGTTTAACATGGAAAACGGTATAGGCAGCACGGGAGGGCGATGCCACGAGCAAGCGCAGCGAGCACTGGTGAACAG
CGCGCGTGTTCCCGACGTTGCACACATGCTGATCAACTAGAACTTGCATGTCCGAGTCATCCGTCGCCGCCATAAATGAAGACAGGAAAGAGGCTTGACG
TAACAGCAAGGGATCTCGTGCCGCATCTGGTAGTGCCGTCGTAGCTTTCGACCTCTTTCAACCGTAAATCAATGTATAGTATTTTGCTTATTCCTGGTTT
CCATGCTACAGTAGTAAATAAACACTTTCCGAATCATTATAAATGGCTTTGGCGTTGCCACCGTTGGCCGCTGAATCGATTGCAACAAATTTCCGGGTGG
ACATCGTTAAATATCCCCCACAGTACCAGGCTAAATCGTGCTCGAGCATTCAGCAAGCCAATATATCAGTAAAGTTGTAACTTATGGCGAAAAATTCAGT
CACATTACATTCAACAACCACCGGTATGCACATTTGCTCTTACATTACATTAATTTAAAGCTCATTGAAACAGCGAGACCAGCAGTGTGCCCCCCAACAC
GTAAGTGCTTTTCACAATAACACGAACTCACTGTAAGTGATTTAAAAGAGCTTCAAGATGAACGACTACACGTCTCACTCCACATACATGTTCGCCAGAT
TCACTATACAGTAACAAACATTTAACAAACGCTAGTGTTAGCTATACATTTGGCGTTTGTGTGAACACGCAAGACCAAAAGTTGGTGTCAGAATTGCACA
TTGCTACTTTAACTTGCTCAGGAAATAGCATGCCATTGTTGAGAGCAACGACGTCTTACTTCCTGCGCAAATGACAATACTTCGTCTATTTATCAAGGTT
GTCAGAATAATATACCAAATGTCAGGGCAAAAAGAGAATTATCCACGCTTTCTTCACAGCTACAGAGCATACATCCTGGCTATTGTCTCCACTATATGTC
ACGTCTGGCCTAGTCACCGATTTCTGTATCATGCCATCTTCGTAATCGGTTGCCCCCGCTGCTGCAGAACTGTGTGTAGCAAGCGATTTATAGATTTCTT
CAGTCAACGATTGCAGCAACTAATATGCCAACTAATTCTAGTGCTGCCTTCTTGCTTTCGCATGAGTGGTTCGTAATAGTTAGCGGTAGCATAGTATAGT
CTTTGGATTTAGACTTCACTGCTCCATGCCAGTTTTGCCAAGGATCTATCAGTGTACTGACCGATACCTTGAATTAGGTTATCTATGAATAACTTATCCA
AACGACTCTTCAGTATATTGTTTCGTACGTTAGCGGAGACTTTTTACGGAGCTGCCTCATCTCTCATATGTTTTTTTTACGGCGGGCTCCAATGTCATTT
GCCTCCGTTACCACATTTAACCGGAGTTCAGCCACCCCTTGAAAAGGGTTCCTTGGTCCATGTGCATAAATGTCGGTCGTCAACTCTTACCTTAAACTTC
AACGATTAACGCAATTGTTTGTTTGCTGACACAAACGGGGCGATCTTCGGTTTGATAAAAAGTTGACCTCAGTTTAATAACTTGTTATACCTTCGAGCAA
GGTAACATTTGAAGGGTCGCGTTTGAGCGCCGTACAACATGTGTTCGTGTATTCTTAAACATGGTAAAATTCGATCATTATAAGGGGGGCTATGCCCCAA
TCACACCTACAGAGAACAGGAATGTTAGAAGAAGAAGAAACAAACACACATACACAGTCAAACATGGCACCGGATTTACTCACCGATATTGAGTGGGGAT
TTTTGGCACCAGGCATGTAGACCTCACCACCCCAAAAAAGGATTTCATCGCCAGAGATTTGGGTGGCTCAACACACCAGAGATTTGGATCAAAGTTTGAT
CCCGGTGTTTTGATTCAAAATACCAAGCTTTGGGCTGGACCACCATAATAGTTGATAGCACTGATCGGAAGCATACCAAGACCACATATGTGGCCATTAT
ATTATAATAACGCTTGTACGCTGAAATGTCCCTTGCGGCCTGCCACGTACGTCGCTTTGTGGGCCGTAGATCACTACAGGAATCCATGCCAGTAGTGGTA
CAGTGGTAATTCACGGTTTGGATAACACGAAACTATTGCTGGTTGCGGATTAGTTTCGCGTACTAAACGGATTAACCCCACGTAGTTTGCTGGAACGGAT
TAGCTCCGCGTAGATTATCAGGTGGCATGTCTAAAAAAACACATCGATGATTGTTGGCAGTGCAAGCTTGTTGGCTGGCTTCGTGAAGGACTACCAATTG
GTACAACATGCACTTTGGACGCTGTTTTGGGCAGTGTGAAGCGAGAGCTGATGTAGCGTAATGTATTATGCATGATGCCTGTCACCAACGGTGCAGCTTC
CGTCAGCTTCGGCTTGGTAATGTACTGCTCAATTGTGACTGCCGATGTGGTGAATGGTTACACACAACAGGTACGACCTGAGATGCACATGCATATACTC
TACTCCCGCTTTGGTCGTCCCTCACCTCTATAATGCCGCTGCGTGGGTCGCAGAGCCACTCGGCTAGCCGATATTATCTTATATTATCTTCAAGGCTTAA
AGCTGCAGGTCTCTAAACGCTATTGGCGAAAGTGTTAAGGTCAGGGAGCCATTGGAGAGGCTCAAACCTGTTCTCACCACCCCATCGGTTCTGTTTTGGC
TTAGCCGTTAGGGCTACTGAAGGCGTCGTTGCAGTGGTGCCAAGCCCCCGGATGAGCCCTACGCGCAGGTAATCTCTGTTTTAAACTCTACGTGCTGGTA
ATCCGAATGAATTATACACTCGGAAGTAATCCCTTTTCTACGTGGTTTTAATCCTCCCTCACTATTGCTTGTTGGCCACTTTTCAGTCTTTTCCGTATAG
ACTGATAGTGCCCAGCTTTCAACACCCTTTGCGGTAGCTGTAAATCCCCGCCGACACAGCTGCAGCGACTGCACGCGTTCGCAGTTATGTAGGTTCATGC
GCACTGCGCCGCGAGCATGTTCCTGAGGAGCGGATCTCCAAGCGCTGACTGTTGAACATCAGCTAGCGCCGGTATGAGGAGCTGCGCGAAGTCGACCCTA
CAAGCTTACTATGATCGGTCGCCCTCGTTGCCTAACGCACATATTGGATGCTTCGGATAGCGTAGAGGTCGCGCCACGCGACGTTGGTGGGGTGGAACGT
GTCGTCCGTGGAATGCACCAGAGCGGTGGGCGGCATGGGCTTAGACTCTAACCAGTTACAGTAGTAGCAGCAGTAGTTGGACAAACAGCAGTAGCAAGCC
CAGCGGCCCATGTAGGCTCAGCAAGACCACACAAACTCAGCAAGCCAATGCAGCGTCCGCTCGCTACTGCTGTTGAAAAACTGTGCACCACAGTGTCCCT
GATAGCGCTCCATTATTTCAAGTGGGCTTTTATAGATTTGTACTGAGTCTAGCGCGTGAATAGTTTGCCTTTGAGGAGCTCGCACTGATGCAAACGTACT
GGTTAAGAGTAATTAGCACTAAATTTTGTATGCTGCTACTAAAACACTGGTGTATGAGATCTGAAGTTACATATTTCACGAATAGGTACGCTCAAGATGT
GTGCGCAACGATCTTAAGGTCTGAAGGAACGCTAAGAATGTTGGCTGGGGTGTAGTTCTGGTCAATTACATATAGGCGGATGATCTCGTCCTTCATCTGA
CGAGTAATGGCATAACGACGTTGGGAGGCGACACTTAACCGGTGTTCTCCACCAGTATTGTAGCGAGTCTCGGGACACCTGCTCGTCGGTGGGTCCGCAA
GCTCGCTACAGTGCTGCTGCGGGCAAGGTCCGTGGATGCAGAAAGACAATGACACACTCAGCAGCCAGAACCCCGCAAAGAGTCCCTATTTATTCACTTG
TTCGTCAATCGCGGCCACTTCAAGTCGGCACTGCAACCTCGACCTCTGCTGCTACACTACACGACTTTACAGGTGCACTCCACGTCACCAGCAAGCCTCC
GGTCAATCCGTCTGACTTGTCCTGTCTATTCGTAGCTCGTCCTGTACTGCCGGCAGTTGCTGCTGCTCTACTGTTCTGCTGTTGCTGTCTGTGACTGTCT
GTGGCTGTTGCTAGTGTTCGCTGTCTGGCAGATTACCAAGTGAGCCCTCGCCCGCGAACAGCCCGTCGCTAGCCTCGGACGCCCTCAGCCATCGGTTCGC
TCGGCTGCTGTGAGCCGCTCGTGCGTTGCTTCGGTGCCCCTCCGCGCAAGATCGCGCCTCGCACTCGCTGTTGGCGATCTTTCCGTCTGTAACCCCCGTC
CTTCGCTGCTCGCCTCGTAGTGTGAGCCAGCTGCGCTCGTGTACTCCTTCAGCATGGGCCTGCTGGACACACTCACTGTCACGTACTCGCTACAGTATAG
ACTACTTTACTCCTCTCGGTTCGCACCGTAGCACCTTCAGCCAGTAAGTACACGCTGGTGAGCCTCGGCGTTGCATGTTGTAGTAATACACCCTGGAGCG
CATCCCGTGCTGGTCGATGATGATCGCACAGACTGTGCATGTCTGTGGTAGGTCGTCAATGATCTCAAGCCATCAATGTTCTGGAGCGCTGCTGCCTCTG
ACGATACCCTGACTATCTGGAATTGTTGTTGGGCTAGCAGTCGAGATTCACATTCGACCTGGTGCTCAGAGCTATTCACAATGTGCCCAAATATAGCAAC
CGTATGGATTGGTACAGTGTATGTGCATCAGGTTATGTTCAATATTAAAGGGTGTAATTCGTAGTTCAGGCCTTAATCGAAAAGTCAAGAGCTTTTGTCG
ACGATTACAGCTCTATCGTAATACAGCTAACAATTCCACACTCACGGAAGCTGTGGGCACATCTGAGTTATTATCTTGATCATCAATTCGATGATCGCCT
TGATGCGACAAAAAAGAGGTTGCTGTGGTGTCGAGCATTACTGTACGCTGCAATACGTCGTTTTCGACGTGTCTCGGAACACCTGTGGTGTAAAAAGCTG
ATACTGCATCAGTACTGCTACTGATGCTAATTGCTGTAACAAGAGCGGACTGCGGCCCGCGTTATTTCAAGGGCGTGCCGCAGGTCCCTTTCAGAAGCTG
TGTGTCCGACTAAAGTTGCCCCCATAAACAGGCCTCCCTAATTAAGGGAAATTGGTACGATTTCCCTCGCAATACCTATATTAAGGCGCCCGCTCATCAC
TCGCAAAAATATATGAAAATCTGATTTTTACCCCTGTTCAAATTGAAACCGGAGGCCCCCGCAACAGAGCCCTTAACGCACTTATTCACTGTATTGAAGA
TGCACTATGTAAGGGTGACTCCACACTAAAGTAGGATTTCTAAACTACATACCATGCTCCGTGTAGATCGAGCGCGCCCTACGAAGGTTGCCAAGAAGCT
TTGAGCCCCCCAAAGCGTGCTACAGCAGCGTCACGGTGTTGAAGGGGAACCGGGACACTGAAGCGGGACACATTCGGTGGCAAAAGGTCACATTAGGTCC
GATCCGGTGCAAATCGGTCGTGGGACATCCCCTAGCATTTTCGATAGGCTGGCCCTACAGCCCATGTTTCGGAATAGGGTTAGGGATAAATGCATACTAA
AACCAAGTAAGATCTCCAAACATGTAAAACATGTGGACATCCATGTTTCGGTTTTCAGGACGGGTGTCATGGCACCCAAATCTATTGCAAATCCCTGAGA
ACTGGGTAATCGAGCTGCTAAATGCGGCTCTACCTGTCCTTTAAACCTTTAGAAGGCCGACCCAGCGCTAGGCAGGGAACTGTAGACCTAAGTCTTGCTT
CGGGGCTACGTTTGCGGGTTGTTCATGCTTCTCAAACGCCACTGATGCCGATTTGGTCTCTGCATCACGATAGATTTGCGAGCCATTTCACCCCCTCCAA
TCCGAAAACATGGGCTGTACATTTTCCGTTTTCGATACACCCAAACGAACAGCACAGCATGTGCTGCATCTTAAAAAAAACACCTGGCACCTGTATGCCG
CATACATAAAACACATACAGTATGTGTTCTCTCAGCGACCACGTTCGGGCGTTGAGGGAAAAAAATCCAAAAAGTTTTGTGGATTTGAAACCAACAACAG
TACCTACAGTAATCAGTCTGGTGGGATGGGAGGTCTAGGGTATCTGTTACACGCTATTTGACAAACATACTTCATTTTCAACAGATTCTACTCAATGAGA
AATGTCTGTTATAGGGGTCTGTGGTATTTATTGGATAAAAATTGTCTTGCCTTCAAAGTACGAAAATTGCACTTTTACGCAAAATTGAAGATCAGACTAA
TTTCTGTAAGCACTACTGTACTAAGGGTCCTAGTGTCCCTGTGGGTAAGGCCCACGAAGATCAAGCGTTCCACTGAGGGTTCGAGCCTCGCCCGGAGCGA
TTCCCATACAAAAGCCATGTAAGTCTATTTCCGACCCCCTACTACCTCCATCACTACATCCCCTGGAACCCCCTAAGTAACCCCCCCAATGGAACTCCCG
ATTAACCACTGCAACTGCATCCCCTCAAACCGCCGCCTCACCACGACCCCAGGAAGGGAAACCGATCAACTAGGAATAGTTTAGGGTAACCCACTTAGAC
GACAAAGTGCTAGCTTCCAGCAGGCTCCGAAATAAGTGCCTAAATATACGCCACCAGGTCAAGTACATGTGGCCTTCTCTCTCTGTTAAGCACTGTACTA
CGTACATGTATGCGGGTCAGGGCTGGTAAAACCTGTCGATTTTTTGAAATGGAATTAGGTTTTTGGTTTTACCTTGGTTTAAACCAATAGAACCTAGTTT
TAATGCAAATACTACTCTTCACTACTGAGTTCTTGGTCATTCTCGTAACTATCGCCGTTTTCGCGCTTGTAGTTGTGGTTGGCCTTGATGTAAAGAAGCT
TTTCGATTTTCGGTGCACTCAGCGCATTTCTAAGTTTGTTGTGAATGAAGTTTCTAGTCGAAAACGTGCGCTTGGATGCAGCACTCGAAGCGACTAAGCT
GAACACATTCAAAGCCAGCTCTCTGAGTGTCGGCCACCGCGAACCCGTTGTCACCCAAAAGTCGTATACGCTTTTCACCTTCTCTTCGAGCTCCATATAA
CGTCGATCTTGATTCGTCTTCATCTTATTGCAGTACACTTGGAAAGCAGTCAGCTCGACGCTCATATTTTTGCTTCGTGTGGTGTCACGAGTGATGGAGC
TGGTATCAGACGCAGGAAAGTCGACGATAATATCTTTTTAAGTCGCGATAAGCAAGCTGAAGTTCCTTCAATCGAACACTATGATGTCTAATTCTGTGGC
ACGTACGAGCCTCATACCCAGGATACTGGAACCTGATTGGTCGACATACTGTATTCGGCAGTTGTGATTGGCTACGAGAAGGTAACTTCAACTTGCCTTC
CTAGCAACTGTTAACCACCTAGTTTTCTGGTACCCTCCTAACACGCGTCGAAGTTAGAAGCTAGGACGTCGTGTACTTGTTGATAAAGCACAATAGAACA
GATTGGTCAAGCTAGTTTTTCTAATTCCAAGTCAACTGACTCTGGGAAAAACCTGTTGGCTGTTTTGGTGGCTAACAGGTTTTACTATAAAACCTATATT
AAACCTAATGATTAAACCCGATGTGCCAGCCCTGATGCGGGTGTTCCTCTCGGGCGTCAATAGCACTCCTATTGCGAAACAGGTGAGGGCATGTGCTTGC
AACAAATGTACGAAGCTACGCCAACTCAACCCCTTTTCCCAGCCTTGGTAAATCGCCAATGGCATGCGAAGAATAAAAAAAACTGGACACTCGACGAAAA
ACCAAAGACGTGTACAACTGTACCTACGGTGCCATCTCATACATCTTCGGTTCTTCTGCTTAAGCAGCTGTGCGGTACTTAGTAATAAGTACCGTAAATA
ACGGCGAACATGCAACGCACGGCGAAGATGCAACATTACCGCCAAATTACTACAAATACTGGTATTTTATCTTGGCTTCAGTATTGTATGAACTTTTTAC
AGCTTTTTACGAGTCAATTGACTTTTTACATTTTGACTTGAAAGCTTCTTTTTTACGACGTTGCATCTTCGCCATGATTTACGGTACTAGTTACTCATGT
TGACGTACGTACCGGCTCATAACCACCACTCCATTCACGTCCAGTTCCCGATCGGGCCCACTGGGCGTGGTTGTAGAACGAATGAACGTGGGCCCACCTC
CGCTCACTCCTCAATTTCCTCTAGAACCCTCAAGACAGCAGCTCCTACGACGCCGGCACCAACGTAAGCGCGATCTCTACCTCTTGAACGGATCGAAGCC
CGAGTACAAGCA