Description :
Non Conding Region
Location :
Scaffold_1:25445- 25534
Sequence
89 bases(100 bases per row)
GCGTCGGACGACGTCCCAACCGGCACCCGCGAAACGGTCCATTCCGCCTGTCGCCGCTTCAAATACCGCCAACGACGCGAAGGAGATAG