Description :
Non Conding Region
Location :
Scaffold_1:25009- 26608
Sequence
1599 bases(100 bases per row)
CTTTCCTACCCCGACAGACACTGTACGATACGAAGGGTTGATTATAGCAGAGACTGGCGATATGTTATTCTTGTGAAGCGCAAAAATAAAGCACTACTCG
TGGCCTGTAACTTGAGACAACAAGGATTTATGCGTTTCTTCTAATAGTGTCTCAGTACAAGCGTCGCCGAGTATTTTTATAGCTGGGTTGCAAACGATTG
TGGACGGTGCTTCCGATCTTTGAGATAGCTAATGAAGACGCTTAGTGCTCGGCCGGTCATCTCGATAAGCTTTTGACCAAGGCCGGCAACTGATGGCCAA
TATAGTCATTATTTACAAATATGTCATCTTGATTTATCAGAACCTCTGCTTTGGATTAAGGTTTCGCGTTTTCCTCTTCTTCTTTGATCGTTTGGTGAAC
AGACGCACCAAAGTTTCATCATGTACAAAACATATCATTGATTCTATACCGACCCGCTACAGCCTACACGCCATAAAGTTCCGTGTCGCTAACCGACTCA
AGAAACGATACGTGCAACAGCCTGCAATGATAAAGGCGGGTTTTTGAAGCATGTGGTAATTCTTCATATGCTATATAACGCTCGCTACAAATTCCAAAGC
ACATCGATCGATTTTTCAATAAAACATTTGCATGAGCTACAATGGACATGGTGATGATTCCTTCAATCGAGAAATTTAGAGCGATGGCAACGTGAGCCAA
GGAAATATTACCATTCTTGATCGAACATTCCTATCCAACAAAGTAGGCTTAACTTCGGAAGGTTTTAGTGGTTGATAGCGTGCTCAATTTCTTCCTCCGA
GCTGTATGAGCTTGTAATGGTTATTTGCACCCGTCATAACCATGCGATCGGCTGTGACTGTGCTCATGTTCAATAACTGAAAACGCTGCAGAAATCCTCG
TCATTGTAGCCTTTCATTTATTAATGCTACCAATAATGTTGTGGACTGGGCAATGAGATAAAGTGGATTTGATCTTTCCGTAACGAATGCTGTCACCAAT
CTTAAAGGTCTAAACAGCTCACAAGTATTCTTCGGTAACGTGGCCTTTTTTTTGGAGAATACTGCCCTTCATTAGAATTACATGAGGCCAAAAGGTCAAA
TAAATGCAGCCGATGACGTAGCCATAAAGCTAACAGACCTTTAGTCGGAATTTTTTGTGCAACGAGGAATGCTAGCGGGATCAACTGTCGATGGTGGCCG
TAAGGTGATTTTTAGCCTATATTTCATTGCGAGCTTAGTTTCAATATTGAAAACTTGTAGAGGCGGCAAATTTGTGATAACGGCGGCATTAGGAGGCCAG
TTCCGGTTGCACTAGAATTGTCAAAGTTTTAGAAGTTTGGCACTGTGTTCGAAAGCGCAGCTACATGACTGTGTCCTGTATAGGTATAGTGGAAAGTAGT
TAGAGCACGCCACCTGAAAGTATTGCTTTCACCACCGCTTCCTCTACTTAGCTTGAGGAGCATTAATGCACTCATGTAGTGCTTTTGCAGAGAGAAAAAA
TTCTAAAACGGAATAATTGCTATGCGTTAGAAAAAATGGTTTAATCTTCGCTAAGTAGAGACTTTGAACGAGAAAGAGATGCATTTGCTCGCATCCACA