Description :
Non Conding Region
Location :
Scaffold_1:24687- 39193
Sequence
14506 bases(100 bases per row)
GGTGCGATTGCTATTCCGTGGATGGAGTTGCGGACGCGAGATGCTCATATTTGAAGGTGCTGTTGGTCACCCGTAGTGAGCCATCCCCGGGCAATGGGCC
TCTCGTTGCGTTGGAGCTGGAGCCGGATACTTTCTACCATCGATCTCGATGAGCTCTATCGCTTCTCTGCGATTGTGTCGTTTCTGCACGCGCCCCCACA
ACCATATCACCATGTACATCTAATAACTGTATACAGTGCGTGCTCCTTGCCACAACGGCAGTGTCAGAGTGGATCAGGCTGATGCGCTGTGTTGCTCCGC
ATNNNNNNNNNNCCCGCGGGGGGCAATCTCATAAATTGCTGGCAGAGGGGGCAAGGTCTAAATGCGCAAAACTGTATCATGCAAGAATGGTACCGTTTAG
GTTCGCTGGTGCCCAGGTATTCTGGGGGTGCAACCCCAGACCCCCGCAACTAGATTTATGAATTCGAGTCGTCGGCATGGGTCCGCCAACGACAACAATA
GAATCCACTCAGTTGTGCCTTCACTGCGTACTTTGAGCACCTGTGCAAACCTCGATTTTATACGATACTGATCCACTTACATTTGTTTTCTCAATCCACT
TACGTTGCGACAAATACTAGTATACAGCAATCCCCTTACATTATTTGATAACTCCTCTTTATCACACTTGCAGGAGATGGGTGCATTCGGAGTCAAATGG
GTTCAATCACTTCTCATCTTGTGTGCGGAAGGCAGTGAGCGAGTTCACGTGTAATAATAGGGCGGTTGCAATCCTTGGAGAGAATCGTGTCTTTGGGCAT
ATCAGTTCGGATGTCTGAGCGCGATTTCTCCAAGTAGCATCGCCCATTTCGAAAGCTGCTCGGCTTTTACAGTCTTCTCCGTCACCGTGACTTGACAAGT
GGAGAGGCTGCTTCGTGAGAGGATTGCTCAACCACATCGCACCACAACGGTGCGATCTGGTTGAACAGCCTTTTCTCATCGGTAGACGAAGGGTCGATGT
GTGGACGTGCACAGTGACTTGGTTCACCTCTTTCTCTTATCAGAACGGAAAGAGCAATTGCGGCCGAGAACGGTATACACTGGTACACGCAGTTTGGGGC
TCCCGCACACAACTTTGGTTGACCAGCACATTCGCCTATCCAGCCTTTCAAACAGGATATCGAGTTCCCATAAATTATTAAATATGCCCGTCAACCCTTA
AACCCTGAGCCCTANNNNNNNNNNGCCGACGAGCTGTACGCGGACCACCCATTCGCTGGTCCGCCTTAGTTGTCTCGCGGCGTGCCGTTTAACCACCGAT
GCCCCAGGACAATGTCCACCCTCAGCCCCTTTGCCCCTCCGAAGCTACTAGGATACATTTACCAATAGACTTCATTAGCATCATCATCAAATGTTAGAAG
TCGTTTGCGACGCACTCGAGTCTCCTTCGCCACCAGAAGAAGCGTTTCCTATGCCACCCAAAGGAGGTAGATAAAGGAAGAAAGAGGCAAAGGGGCTTCA
CTTTGGCCATTGCCAGCAAGATCCTTAATGGCGACGTTGCTCCACCTGCTTCTCAGCGTGCGTAGGCCTGCACAAGAGTACCCTTCAAATAACCCCAAAA
TAACCNNNNNNNNNNAAGCGAGATGCGTCAGCCAAATCGAGCTTTCGCTCGATTTGGAAGTGTTCACCTCCAATAACCTATTTCATGTACTGATATAGGT
TAGTGTGCTCGTCACCCAGAATCCGTGAGCCAGTACAATGGGAACGATCCATTGTGACTGGCCATCACCATCATCATTCGTATTGTGACTGCCTCGCTCA
TGTGGGATAGGTGCATTGGCATACAGATAAATAGGAAACGCCGCTGGACCGACTACAACCATCGCACTCTNNNNNNNNNNTCTATCCACCCACAACAGGT
CCGCATCGAACGTTAGAAGCTATTGTGCGCAGAGCTCGCACGACAGCACCAGGACACCCTTCGCACAGGCATCGGCCATGTGCATGCAGGTGCATCCCCA
GAGGTGTTGTATCAAGCGCGTCGAATTGGAATGCCCATGGCACTCAGACTTCTTCATGGCCACTGAGATAAGAACATCTCAGTCCGTCTGCNNNNNNNNN
NATTTAGTGTCTCCCAGCTTGTTGGCCCAACGGTGGTCGAGTGGGCAAGTACGTCAGCGACGTCGAGTCCGACGTGAGCCCATTCCACTTTTCCAAAAGA
CCATCGCTACAGACGGACACTTTTAATTAATCCCGACCAAAACACCGTGATGCACCTTCTGATCAAGCGCACACTCCGCTCTGTCGCGACCACGCGCCGA
ATCGCGACCTCCCGCCCGCAGCTTCCTCCGGCGCAGACGCTTCCGGTGGGCGGCAACTACGCGCTCAAATACATCGACATTCGCCCCACGACCAAGGACA
CGACCGAGAAGAAGCCGACGCTCGTGCTGATCCATGGCGCGCCGGGCTCGTTCCGGGACTTCAAGTATCTGATCCCTTTGCTGCAGGACAAGGCCCGCAT
CATCGGCGTGAACCTGCCCGGCAATGGCGAGTCGCAGGTCATCGACCACGCCAACTACTACGACAACATCGATGCCATCAAAGTCCATCGGTCGGCGTAC
GATGCATTGGTGCAGTTGTGTGGAGACGACGAAGACGTGTTCGTGCTGGGCCACTCCTTTGGCGGCCACGCGACCATTAACCTCACGGCGTTCAACCAAG
ACGAGCGCAAGCTCAACATCCGCGGCGTGGCGCTCGTGGCGTCGGCCGGACTTCGGCCGCACAAGGCCATGCATCCGCGCTCGAACGCCATCTTGACGAA
CCTGCTTCGCTCGAAAGTTGCGCTTATCGAGCAATGCGCACGCGAGCTCACCCGGCTCATCTATGTCAAGGTGTTGGGCTTCCCCGCCAATGCATCGACC
GAACATTTCGTCGCGGGCATTGTGCGCTGCGCGACCACCGACTTCAACGTGATCAAGCAGCACGTCCAGCGGATCCGCAACGTGCCGGCGTTCTTTGCGT
GGGCCAAAGACGACGCGCTCATGGAAGAGGAGATCTTCACCGAGTTGAGCCAGCAGTGCCACCCGGGGCCGCGTCTCGCTTTCGACAACGGAGGCCACAA
CATCCAAAAGACCAAGGCGCCGCTGCTGGCCGAGGAGCTTCTGCAGTGGACGCGCGCCGTGATCAATGGAAGCGGCAGTGGCGTGATCACCCAACCTCGC
ACTGAATAAGACACCATAATGCACTGATTTAGACAAAACATATGGCAAGCTGACGTACTTGGCGTATCAGTTTGCGTTCTATAGCGTTCTTAACTGTAGC
TCCTCGAGAGATTACTCCATCAATCGCTGACGGCAATCGAGACCTCCGCCAGTCGTTCTCATTCATTTAGAGAAGATGCTGCCTCGTACGATCGCTCGCC
GCTCGCTGCTGGCCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCGTCGGCCGTGGCGCATGGGCCGCTACTGCCGCTGGGTCGGGACCTCTTTTAGA
TTCGCGCGCTCTGTCCACGACCACTGCACGTCGCAGACCGGCGCTGCCGGAAGCCAAAGCCATTGATGTGGGCGGGGCCTACTCGATCAAGTACATCGAC
CTGAAGCCACTAGCACCGGTAGCGACAGAGTCAACGACCCCGACGATCGTGCTGATCCATGGCGCGCCTGGCTCCCACCAGGACTTCAAGTACCTAATCC
CGCTGCTGCAGGACAAGGCGCGCATCGTCGCCATTAACTTGCCCGGCAACGGTGGCTCGGCCGTGCTGGACGAGACCACCAACTACTACGAGCACATTCA
CGCAGCCAATCTCGGTCGAGTGGCTCACGATGCACTCGTGGATATCTGCGGTGGCGACGAGAATGTGTTTGTGGTTGGCCATTCGTTCGGTGGCCACGCG
ACGATCAACGTCGCCGCTCTCAACGAGATGGAACGTGCGGCCGACCGCAAGCTCCGCATCCGCGGCATCGCGCTGCTGGCATCAGCAGGTCTGCGCGTCC
ACAAAGGCATTGAGAAGAGCCACTTGCACGTGTTCCACGGCCTTCTCGCCTCGGAGTATGCTCTGGTGGAGGCTGTCGGCCGCGCTGCGACGCGCGCCTT
GTACACACGGCTGTGGAAGTTCCCATCGAGCTTGCCGACCGAGGAGTATGTCGCGGGTCTCGTGCGCTGTGCGAGTACAGACTTTTCAGCCGTGAGCGAC
CACGCCGCGCGGATCGCCCACGTGCCGGCGTTCCTTGCTTGGGCCAAGGACGAACCATTCATCCAGGGCGAAATCTTCCGTGAGCTAAGCGATGCGTGCG
CGCCAGGTCCGCGTTTTGTCTTTGAAACGGGCGGCCACAACATTCAGAAGACCAAGGCCGAGTTCCTTGCTGCGGAGCTGCTCGAGTGGATGCAGCGCGT
CGTCAGCGGAGACATCGCCACCGCGAACGCGACGCGCCAGATCGATGAACTCCCTTAGACGTGTTGGGCACAAAACAAATCTTTTTCTTGGTGGTGATCT
GTATCGCTGACTCGTTGAGATTGAGTGGAATCTATTGCTATGGCGATGGTAGTGTTCAAGTAGCAACTCGTGGTTGGAGGCTTCACGCGAGGCTCCCCTC
TGCAGATCAACAAACAGACGTCGCACTACTGACGAGTGGACCCAATAGCACAGAGGGATCGGATCTCGCGGCAACCCGGGTCCCGGAGGCGCCGGATCGG
TCACCCTGCGCACGGATGCAATAGCGTCCACAGCAACAGTAAGCTGGAGTGCAGCTATGAGTCTCGCAGAACGCACGACGACAAGACGACCAGGCAGAAC
ACGTCGGCCCTCTCAGTGAGCTCCAAGCTGCTCTCCCGCATGACTGGTCTCCTCTTACTGTCGCCGGCGACAGTGCACTCGTGCTCCGTCAACTGCCACG
CCCACCATTGCAAAGCCCGAATCCTCGCTGATCGGATTGGCGTGACTTCCCCGTCACACCACCTCTCGGCCTGGAATATGGACTGCCAACGCAGCCTGCC
TGCAGACCATCCACCGGGCTGACCGCCTTGAGCTGACCGCCACGCTTGTACGTATTATATTTCTTTGGGTCTCTTCATAATCTTTCTTTTCCGTCAAGTA
GAAAATACCGCTCGGCATTAATAAAACAATGACTGAATCCACGCCAACCTCAACAACAACGTTACAACGCCGCCACCAGGTGCTTTAGTGTATCAATGCC
ATATGGATGATGGCTACTCATGAGGAGCTACGAAGTATGATTGGCTATATGTATTCACACGCTTCTGTCTTGCCGAGATTCTGACGTGGCAGTCCCATGC
CACCTCAGCGAAGCGCATTCGCAGTTGCCTCCCGACCCATGCGCCGCGGCGTCTCTGAGCTCAGCGCGCATGTGCGTTGCGCTGCGTCTCTAGTACAATG
CGCAAACCCACGCGTGGAAGCGGTCGCAACCGCTCACCGCCGTTTCATTGCGCCGCTTTCGATCGGATCGGCACGCCACTTCACCAGCTTCTTGCCGACT
GCCTCGCGTCGTCGTCCGCAACAGAAATCCGTTCATCCGCCGCCACCGCCACTACCGGATGCAAAGATCGTCCGCGTCGACCACGACTGCGCTCTCGAGT
ACTTCGACTTGCCGCCGGCCAGTGCAGACCCCAGCGAAGCAACGACGCTCGTGCTTCTCCATGGCGCGCCAGGCACGTACAAAGACTTCCGCCACTTGGT
GCCTCACCTCCAACAGCAAATGCCTGGCGCGCGTATCGTCGGCCTCAACCTGCCGGGCTTTGGCGGATCCACAGTCGACGAAACGCGGTACTTCGAGCTG
CTGGACGCCCAACGTACGGCGCAGCTGAGCCTGCGAGCGCTTCACCATCTCATCGACAGGGATGCGCGCGTGGTTCTCGTCGGCCACTCGTTCGGCGGCC
ACGCGGCACTCAATGTCGCGGCGCTCAACTCCACGGCGCCCCCAGCAGACAAGCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCAGGGCTCG
TGCTGCTCGCGTCGGCCGGCACACGTCCACACCGCGCGCTGCGACCGCGACTGAGCGCATTGGTGATTGAGGCGATGCAGTCGTCGCCTCTGGTGGTGCG
CCAGGCACTGGCGCGTGTGGTCAAGTCGTTCTACACGACGATACTGCGGTTCCCATCGGACTTTCCAACGAGCCATTTCGTCGCCGGCGTGCTTCGTGCC
AGCACCACCGACTTTCGAGTGGTCCACGACCACGTCGCGCTGCTGCGTGCCGCACGCGTGCGCTCGCTCAGCGCGTGGTCGCATGACGATGAGTTCATGG
AGGACGCCATCCCCACCGCGCTGGCGGCGGCCCTGGGTTCAGACGCGCGGCTCGTGTTCCGTGGCGCCGGCCACAACCTCCAAAAGACCCGCGCCGACGT
GCTGGCTCGCGAGATCGCGGCGTGGGTCGCATGTGACGTACCCACTGAGGCGGCGACGGCGGAGATGCGTCCGTGAGAGATGAGTGAGGAGATACGGATG
CTGATTCGCTACCAACAAGTCTGGAAGGTTCGGCACGAGCGAGGGGTGCTATTGACAGCAAAAGAACCCATCGACGGGTGGTTTCACTTGGGTTATGTAT
GCCGCAGATGAGCTCGACCCCTGGCTCGTCGCGTGGACAGCGTTCATGGTGCATAAAAGGTACACTGTCATCCTGTTCGGCGTGAATTTCCACGATGGTC
TGGCCCCCATGGAGAGCCTGGGTGAGCCTGGGAGATCTAGGAGGAGTGAGGAAGCCGCCGCGAGAGTCCCGACGCGAGAAGTGGAGAGCACCATTTCCAC
GCTCGCCCGGAGTTTGTGTTGCTGTCAATAACCGACGCCCAGGCACGTATCACGGTGGACTCAGACTATGCGTACGCATTTGATTGGCTATAAATATCGA
GAGCGACGTTTGATTGGCTATAAAGGAGACTGATTTCTGGCTTGCAGAGGCTGGTCGCGCTGTCGCACCATTTTCCAACCCGAGCGATGGCGGCCCGTGG
CGACTCGGACCGCGCGGCGCCGGCGGCGACCGAGACGCCGGTGCTGGAGGCGCTCCACCTGCGAGCGAGCGTGCTTNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCTCGATGGCGCAGG
ACAGCGACCCGTGCATGCTGGGCTCGTCCTTCGACGGCTGGAGCGACGACGAGGAAGAAGAGAAGACGGAGAACGACGGCGAGAACCACCGCACGCGCAC
GGCGGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGCTCAACATCCGCGTGCGCAAGGTGGCATCGACGTCGGCGCTCGACCTCAAGAGCGTAA
AGCTGACGGGTGACGCGTCGTCTCCCGCCGCTTCCGTCTCGTCGCTGCCGCCCATGCTGGAGAACTCGTTCGACCGCGTCGACGTGGAGCTGACGTCCGT
GGTCGAAGAAGGCGGCAGTGCCGACGACGACCGAGACCACGGCGACGAGATGCTTCGCGCCGGCCGCTTTACGAGCGAGCAGCTCACGGACCCCATGCGC
CACTCTCTCCTCACCTACACAGCAGCGGCTCCGCCGCCTCCAGCGTCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTGGCCGCATGG
GCTGGCTGTTCGCGTGGACGTCTCCCCGCTTCCGCCGCTGGTACGGTCGCATCCTGAACTCGTACTTTGCCTTCTGGCTCGTTGCCTGCACGGTCGTGGT
CGCGCTGATCCAGCTAGTGCTTCTCCTCACGGCCATGCTGCTGAACAACGAGAAGACGCGCGAGTCGTCCGTCGACCCTACATGCCACACGCTCGGGCTG
CGGTCGCTCCACTACTTGGCTGCGGTCGCCTGCATGCTGCTCGTGCTGCCTGTGGTGTCGCCCATAGACGCCTTTCGCCTCTACCACAAGCGCGACGCGG
ACCGCCGCATGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCACGTCTGCGAACTGTTCGTCACGGTCGAAGTCATGTACCTCA
TCTTCTTTCTCCTCCACAGAGGCTACAAACTGCCCCAGACCGTGGTGTGCCACAGCAACTACACCAAGTCGGAGCGCATGTTTCTCTACGGCACGTTCAC
GCTCTGGGGCGTGCTCTGGTGGCAGCTCATCGTCTTTAGCCGCTTTCTCGTGCATCTCAAGCTGCAGGCCGACGCCGCGAACGAGTCGACCCACACGTCG
GCGCTCAGCGACTGGCTGCGCGTGTCCAACACACGCGAGCTCACGGCGTCCAAGGCGGCGCGCCCTGTGCAGCGCTTCAAGAAGCTTCTCTACCGCGCGG
CCGCCCGCGGCGACACGGACGCCGTGAACGACCTTGTGGACGCGGCGTCGCTCGAGTCGTTTGGCATCGACGGCGCTGACGGTGTGCGTGCGTTGTACGC
GAGCAGCCCGACGCTCTGGCTCTTTGCGTTCGCCGTGTCGTGCAAGAACCCGCTCCACATTGCGGCCAAGCGCGGCCACGTGGGGATTGTCGACAAGCTG
CTCTCGCTCGGCTTCGATGCCAATGCGCTTGACAAGGTCGCGCGCGTCAACTTCAACATGGGCCTGCTCTTCAAGCTCGCGACGCGGATGCTATCCACGC
AGGACGGCGACAAGGCGCTGCTCAAGCCCGTGCTCTGCTCGGTGCTCCTACCGCCGCTCCACGGCGCCGTCGCGGCCGGCCACGTCGACGTCGTGCGGCT
CTTGCTGGAGAAAGGCGCCGCCAATCCGAACGCGTTACCGCGGGCGTCGTTTTACTATCCATCGGCCGTGATCCCGGCCATTTTCGTGGCAGACGACCCT
GAGATCGTCAAGCTGCTCGTCGCGAAAGGCGCCAATTTCCTCCACGTCGCGACGACCACGCTCTCGGGCTTGGCGTCCAACACATACGCGACAGCGCTCC
AGCGAAGCGCCCTCACACAGCGGTCGGCGACGACCGAGTACCTCCTCTCGTGCGGGGGCGACGTCGCGCTCACGCCGCTCCACGCAGCAGCCGCCGCCGA
CAATGTCCGCACCGTCAAACGCCTCTTGAGACGGCGAGAAAGAGGACGAGACCGGTCCCCGAACAGCCACGTGNNNNNNNNNNATCGGTCTCCGAACGGC
CACGTGAACGCACGCGGCGAGCGCGTCGAGGGCGTGCAGCGCCGCACACCGCTCCACTGGGCCGCCGTCGTGGGCCGCGCGGCCGCGGCCGAGGCCCTCC
TGGAGCGCGGTGCCGATCCGGACGCGAGGGACCGGTACGGACGCACGCCGCTCCACTGGGCGGCGCACAACAACCACGCCGACGTGGTCGCGCTTCTGCT
CGAACACGGCGCCGACGCGCAAGCCCAAGATGATGGTGGCGTGCCCGTGCTGTCGTTTGCAGCTGAGTCGGAGGGCGTCGAGCAGCGCGTGATCGCGGCG
CTGCTGGAGCGCGGCGCGTCGCTCAAGCACGCGCTACCGGGCAGCGGCGACACGCCGCTCCACATTGCGCTCGTGCGCGAGAACCGTGCGACCGCGACGG
CGCTCATCCGCCTGGGCGCCGACCTCCTGGCCGTCAACAGCTACGGCAAACGCGCCGTGGACGGNNNNNNNNNNGCGCGCCGTGGATGTAACGACGTCGA
CGCGCCTGCTGTTCGACCTCAAGAAGCAGGCCGCCACGCGCGACGTCATGATCTCGTACCCGCACTCGCACTTTGCGTTCGCGCAGCGCGTGCGCGAGTA
CTTGGAGACGCACGGCAAGCTCACGTGCTGGATGGACACGATGGATCCGTCGGGCATTGGCGGCGGCGCCGTGTGGCGGGAAGAGATTGCTCGCGGCATC
CACAACTGCTCGCTCGTCGTGAGCATTGTCTGTGGGGGCTACACGACGTCCGAGTGGTGTCTCAAGGAACTCGCGCTCGCCAAGATGATCCGCAAGCCCG
TGATCGCGCTGCTGGTCGAGCCCCCCGTCTCAGTAGTCGACGTCGAGACAGACGCGGATGAGATCTCAGTACTCGATGCGTTCGTGCCACGAGATCACCA
GCTGCCGTTCCACTCGTTTGTGCGAGGCACGTGCGTCATGGACAAGAGTGTGGAGCTGGACGTGGACGACGCCGAGCTGGACGCGGTCTGGCGCGATGTG
CTACCCCGGCTCAAGAACGCCATGCAGACACCCGACCAAACGAACGGCCGCTGGCTCAAGAGCCATTCGACGGTGAGCAGCACGCTGGGCAGCAGCGGCA
TTGGCGGCATCGGCGGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGGCTGGAAAGAGTGGCGACGGCGAGGACGACGAGCGCAAGACGGACG
ACATGGACGACACAGTATCGCAGGCGTCGTCTCTCGGCCTCTCGACCGACTCGACACGGAAACAGCTCTCGGTCGCCGTCTACTCGACGCTCCCGCACAG
CGCGTTGCTCGAGCGGCTCGTGCAGGACATGGGAAGCGAAGGCTTTCGCGCGCGTGCGCTGACGGTCGACACCCACGACGACGCGCAGTTCACGCACCAG
CTCACGGCGTTCCGCGTGCTAGTCGTGGTGGTCGAGAGTCTGGGCGACGACGCCTCGCGCGAGCAGCGCCAGGCTGCCGGCGCACAGCTCGCGACGCTGT
TGCGCGCGGCCGNNNNNNNNNNGGTATCGCTGGCGTCGTCTCTCGGCCTCTCAACTGACTCGACACGGAAACAGCTCTNNNNNNNNNNCCCGAACGGTCT
GCGCGTGTGTCCCGTCGTCGTGCGTGAAGAGTTCCTGTCGTTTAGCAATCTGTACACGCTCGCGCGGTCCGAACTGCTCTACTTTGTGAGCGGCGCCGGT
GAACGGCAAGCGACGAAGGCGCTGCTGCGGCAGCTGCGACGCGCGGCGGCGACCGACTCCAAGTGAAGCGATCGAATATGAATAGTAGTTGTACAGGGAT
ATAATAGATAAACAAGTTTAGGCACGGGAAGAGCAGCGGGTTGTGCCACAAGAAGAAGGCGGANNNNNNNNNNAAATATGAATAGTAGTTGTACGGGATA
TAATAGATAAACAGATTGAGGGGCGGGAAGAGCAGTGGGCTGTGCCACAAGAAGAAGGCGGACAGCTTTTGGGTTCTGCACGAAAGAGCGGACCCGAGGA
AGGGGAAACCCGGCCAGATCGTTGAGGAAGCCAAAGAGAACCCGGGCCTGGCGGTGGAGAACTGCGTTGGGAACTGACAGGCGAGCGCCTCCATGGTTTG
ATTAGGTTTGCTTGTCTGGTAGTGCCACGCATTCGCTGTGGCAATGATCCAGCTACCCAGTATCACAGGAGAGGCACCGAGAAGCGGCGGNNNNNNNNNN
GAGATCGTTGAGGAAGCCAAAAAGAACCCGTGTCTGGCGGTGGGGAACTGCGTTGGGAACTGACAGGCGAGCGCCTCCATGGTTTGATTGGGTTGGCTTG
TCTGTTAGTGCCACGCATTCGCTGTGACAACGATCCAGTCACCCAGTATCACAAGAGAGGCACCGAGAAGCGGCGGGGGTGCCAGACGTTCCTGAACATC
GGCGTCAACCTTTCGCACCGCGACAGCCTCGTGGCGAACTCACGCTCGCCGCTGGGCGTCCGCAGATATCGCTCGCATCGGCGTCGTTTCCTGGCCACGT
GCCGGTAAGTCGGTGGTGAGTTAGGCGAGTACTCGAGATAAACCATCGGCACCTGTGGGCGTCATGTCCGCCACTCGACGTGGCTCGATGCTTCGTTGCC
CTAAAGGCGGAAATGGAAGTTTGCCGCCACGGGACGAGGCGCCGTGCTGTGGAGACAGCCAGGGGGAGTGAGNNNNNNNNNNTTGTGGAGATGGTCATCG
GGATGAGGTGAGAATGGTCATAGGATGGTGTGGCTCTTGGGCAGGCACCATCCTGCTCACGTGTCTGTACATGGGTGCATATACAGAACAGTTGTGTTGG
TCATGTTGAAGTAGCCAACAATCGTGCGGACGGTACTAATATCGAAGCTCGTCTTTGCGCGATTCCCCCTCTGCGTTGGGCCACAGCAGAGGCAACCAAG
TGCCCCTGCGACGAGCCACTGAAGCGTGCTGGCGCGAGCCGATGGCCATGACAGCAAGAGTCACGAATCCTTCTTTACATGTCCGACTGTCTGCTTCAGT
GGAACATGTCAAGCCGGACTTCGCGGTGGTGATCAAGTCAGTCGAACCCGTTGGAGCCGTCGTCCGCCAGGGATAGATAGTTTAGTGGGACTGGCGTTGA
CAACCCCGGTGCATCTTTGTTTCGAGCGAGATCTCAGCGCTGGATGGACACACATGCCCCACGTGCTGTTTGGGAGCGTCTCTTCTTGAACTGATCACTC
ATTCTTTGTGGCCGATGTCCTACACGACTGTAAGTTTGACTGGTCTTGCGTGTGTCGACGGCTGACTTGGACGGTAGCTTTGGCTTCTTCAGCGTCGCGC
ACGGCGTCCCATACTCTCCGTTGGTACGCAGCCGCGTTCTCCATCGCTTTGCGCAGCTCTGCTTCCAGCCTCTGGATTCCGGAACGCTGTGCGTGGATTG
TTCGCGACAGTTCGATGTCGCTGGTATGTTGGGGTGGGAGCTCATTGCCCCTTTGCGGTTCTGTTGGGACGGTGTGGGCGCCAGAGCCCCCACTGCAGAC
GACCCGCGAGCGTACTTGACCTTGTTTCCTGATTACGCGAGTTGGCGACGAGTGAGGCATGGCCGTAGNNNNNNNNNNGGGCGAGCTCGTGAGAGTGAGA
TGTGAAGACCGCTTCCTGGACTTGCGTGTGTTGACGGCTGACGTGGGCGGTAGCTNNNNNNNNNNCGACCTTGTTTCCTGATCACACGAGTTGGTGACGA
GTGAGGCATGGCCGTAGACATAACTGTAGTATGGTTCATATCTGCCATTCGCTTTGTTGCCCTCGGGTGGCAAAAGNNNNNNNNNNCATCCTCACCTGTA
GTGTGGTTCATATCCGCCATCCGCTCTGTTGCCCTCGGGTGGCAAAAGCGAAAACGAAAAGCACCCACCACGGAAGAGGCGTCGATCGTGACGGTGGCTT
TGCGGACGGCGACCAACAGAACGATCCCACCCGTAAAGAAAAGCCGCTGCGGTGGAGGTTGCGTGGCTCGTTGCCGCGTTGCAGCGCCCGCTTCCGTCCC
ACGTGTCTGTGNNNNNNNNNNGAGGTGACGTGAGGTCTGCCGGACATGGCGATATTCATTTTAGAGTTGTTAATGACGGGACTCGCTACCCATCGCTACC
GCGCATTGAGATGCCTTGCCCACGTTCATGTCGTCGTCTTGGCGAGACCGTCCAACTGGCGATGGAGTTTCTCTACTGCGCGTTCATCTCCACCCGACGC
ACGTGCGCGGTCCTTATTCATGAGTTTCATCGTGCGGATCGCGCCTTCCACAGCGCGCTCTCGGTCGCCCACCGCACGCTCCCGACACGCGACGGCGTGC
TCTCGAGCGTCTGCAGCCCGTTCGCGGGTCTCGATCGCGGCCAAACGCTGCCCGCTAGCCCCACAATCGCCTGCTCGTGCACGTTGCAAACCGACTCAGT
GGCAACAAACAAATCCAGCGTTCTGTGGCCATACCTTGCTGCGTGGGGGTGGCGTTCTCCATGCGCCTTCGCCGTCTTGCAGATTGGGAAATGGCAGCTC
CAGTCAGTCTGCACCGTGCTGACTGCTTCATACCAGCACCCAATACCACACAGCACGTCTGACGGAAACTGCGTGGACCACGACGCGACGACTGGTGAAA
CGTGAACTGCACTCGTCATGATGGGGGACGTTATGCTGGCGCGATCGTTATGGATACCTACCTCTTCATACAGTAGAAATGGCCAGCGAGGATGAAGGTC
CGTGGCGAGTCAGTTCAGACCGCCCGTCTCACCAGGCAAGAAACATGAGATCTCAGTGATCACCACACGTACGTAGTAACTGAGTAAACATCGTAGTGAG
GACAGAGAAGCAAAACAAAGTGAAGCGAATCGGCGCAAACCGGCCTTCCCCCATGAGGATATTTCCCATTGTGCGTGCTGCACCGTCGCTGAAAGAAGAC
GCACCGCACGTCTCTTGTTCATCCTTGCTCCGTCCGCCCGTCGTCCTCAACTCTCACTAGTCACCGACTCGCCCCTTGCTTGGGAGGGTCTTCTGTGGCC
ATGCGCACACCTCGCACAGGTGTCGTTCGTTCCCTCACACCGACGGGAAGCCGACGCTATTGACTCGGTGTATCGTTGGACGCCGTCAAGTCATACGCCG
TCCACTGGTCTGGCGGGGTCGGAATCACGGCAAACGGGAGCAGCGTTTAAGCGTGATGCCCCACTGTTGCGAGACACCTTTTCTCTTCCTCGGTTCCTCC
CACGTT