Description :
Non Conding Region
Location :
scaffold_1:24159- 24311
Sequence
152 bases(100 bases per row)
ACTGGGACTATCATCGGTTATCCATGAACAAACTACATATATTCGACAAACTTGAATAATGTAAAAAGATACTACGACTACGATCAAAGACAAGTGTACG
CCCGCTTTCGTTCAGCAGGAATCGGCGCGGGGGAAACGTGGAGTAAGCTGCT