Description :
Non Conding Region
Location :
Scaffold_1:24063- 25265
Sequence
1202 bases(100 bases per row)
CCTCCCCTGTATATGAAGCAATAGATAGAGAGATACACACACGCGCGCAGACGCTTGCTGGATGAAGCGCGTCCGTCGGATGTACCAGAGTGAGTGAGCT
TACTGAGCTGGTGGTTATGTATGAGGCGCAGGTGCGTATGCGGCGGATAGCGTTCTATATAAAGGAGAAACTGGGGGCAATAAGTGCGGCAATTCCCTCT
CGTTGTAGTTGTAGTTATTTATAATGCAATCTAACAGGATACTGTATTACAAAAGTGGTGATGCTTTCATGGTAGTAAATATTTAATTTGATGGAAATGA
TTAAATGTAGAAGGTTATAAGGTATACAGAGACGTATAGACAGAGCGTGGTGTGGGATTTGTATAAATAGCGCAAAAGCCGGTTGAGGGGGATGGTGTAT
GTGTTGAGGGTGGACGAGGAAGCCCTACCCGCAATGGAAGGTTCCTGTTTATGCACAAATGGACTATAACTGACTGAGAGTTTGTATGTGGGTTCACCAA
GTCACGGCGTGGCGACGATCTGGATGGTAGGATTGATAGGCGCAGCCATGTGTGGTTTTTGGCGGCTCTGCGTGGTTTTTGCTGTTCTGATAAGGAAGCT
TTTTTGGACCGGAATATTCGTGCATATAAATAACGGTATGATACGGAACTGCCTCATCAAATGGCCTAAGATGCTCTCTCTATATATAGGTGAGCGTAAA
GATATCTAAATAGGGATTTTTGTTCTCAGCCACACTCTACGCATTTGGCACGCGAATGCAATTCCTCCTGAGCATATACACGTAGGCCGTGTTCGTTGGC
CACATAATACGCATTATGCTGGGTGAGAATGCGCATTGAGCCAACGAACACATGTAAAAGATAATACGTATTATCCGAGATGATATGCTTTTTGTCAGAT
CACGAAAATCCTCATCTGAAGAAACAGCAACTGATACTGTATGACGTCAATATATTATATATAAAGAAAAAGAATAAAAAAGAAAAGAGAGCGAGCGAAT
CCATAAATCCATCATTCTCTCTGAGAAAATCGAAGTTTACAAAACACGGTTTTATATTACGCCCAATATCAATTCAAGGTGGACTGCAACGGTCTCAGAA
ACAATTACTCAGGCCAGGTCACACAACCTGAGTCTGCCTCCCCCATAACTGTAACAAAGCCCCATACAAAAGCGCCAAGAGAAGAACAAACTACAGCGAA
TA