Description :
Non Conding Region
Location :
Scaffold_1:23825- 23936
Sequence
111 bases(100 bases per row)
AGGTACAGGATGGTCGCTAAACGGTACTTAATCGAAATGTTCGAAACTTTTCACGAGCCAATCAAAATGCGGTGTGAAAAGGCACAAGATTTTGGAAGGC
ACAAGTGGTTG