Description :
Non Conding Region
Location :
Scaffold_1:23816- 24321
Sequence
505 bases(100 bases per row)
CCTGCAGCAATACCTCTATCTGAGCAATCAACTAGCACTGCTATTAACGCACCAGCACTGCCATCGCCGTTTGAAAACGACTCCAATGACAATATTATCT
TCCTCAACAACCCCACGGAATTCGATCTGCGCTCCATTTTTTTCAGACGTCCAAAGCCGAATTCCCTCCCAGGCAGTCTAGACAGATCTGTCGCGAGTTA
CGGGAGTTCCACTAGTAGCTGTCGCAGTCACGCGCACGAGTTCACTTCCATAGATACCATGAACAAAGACACTCCATCACAAGCAAAAGCAGACGCTGTC
AGCTCGACCACTGACGGATCCGTAGCGAGCCAACGAAAACGAAAACCACGACGAAGGTTAAGGGCTAAGGAGGAGTTATGCCTTGTGCTTCCCCGGTCTT
CATCCAACAGACGAACGAGTTCGCAGAAGTCATGGTTCCTTGGGCCAGGCCTCATCGGTTGCGAGCCAGGAGAAGGCACTATCGTCGTCACAAAGGACCC
ATCAA