Description :
Non Conding Region
Location :
Scaffold_1:23809- 24731
Sequence
922 bases(100 bases per row)
GTGAGGAGTGCAAGTTGTGATGCTGGTACTTGGCTGGTTTCCGGTAAATTGAAGAATGAGGAGCTGGTGCGAGGGCTCTTGCGCAAAGTGATGAAGTAGA
GTGTGAAACTCGCTTGCTGGATCGCTGGTGTGAAGAGAGTGTCGTTGCAACTTGCAACGGTCGCTATCGTCGTACAGTGGCAAAGATCGGCTGTGGGACG
GGTTGGGGTTGGATAACGTGGCATTTTGTTTACGTCAACAGTTTACTTTTTGTGCTAACGTCATTTCAAATGTCGCAAATCGATCGATTATCTATCAATA
CAGATCCCCCTTGCCAATTAATACCATCCGTGGAAGTTGTTCGTATTAAGTACAACAGCTTATTAACTATCAGAGCGGCGTGTTGTCATCTGTTGGGGAT
ATGCGAGGGTCTATCTCTCCTCGATAGTTACTTGTACACAAGCCCGTGCTCGGGCTGATTGCATTTTACCGTATCAGCGTCCCGTTACATGTACTCTTGG
TTAAGGCTATCCAGCAGCTTTCTTTCCGCCAATAACCTATTTAAGGTATGTAAGCCAAGGCTGTCCCGTAACCTTGTAAGTTGCGTGCAGGCAAAACCCA
AGATTGAGACAAATTCAACGTGCAGAGTCAGCATCGTACAGCATTCAGACGTTCGGATCTGGACGCCATAACGTTGATGTGGCCCCCGGGGGCGAATCAC
AAGGCATTTCGTCTTACTTCGAAGTATAACAGAGGCGGACACTTTTGTCGCACAGTTTACGAACAGTGAGCCGACAAGTTTACGAACGGTGAACCGGCAA
ATGAATAGCAAATTTCACACTCTACTTCATCACTTTGCGCAAGAGCCCTCGCACCAGCTCCTCATTCTTCAATTTACCGGAAACCAGCCTAGTACCAGCA
TCACAACTTGCACTCCTCGCCA