Description :
Non Conding Region
Location :
Scaffold_1:23560- 25406
Sequence
1846 bases(100 bases per row)
CCGAGCTCCGAAGCCGCCTCGTTGCTCTCACGATGCGGCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNGGGGGACTGAGACGCGATGTACCGTAGTACTTACCAAGACACGTGGGTATCCCAAGCTCGGACGGTATCGCGACCAT
AGAAGACGAAGCTGGGTAACAGGTACATGATTCGTACTTCGAATTCCGGATACCGTGCAAATAGGAGGCATGCAATGGCTATAGCGCCACCGCGTCAGCG
CAATACCAGCGGCACACCCGCAAGCGTGATGTCTTACGAAAGGCCATGTCGTGAACTTTCGATTGCACCACAATATAGCCTAATATGTCTCAAAATGAGC
GAGAAAATCAACATCCTTGTCAGCGTCCAGATGCGCCGGATAACTGCCCTTGCGTCACTTCAGGGCTCCCGGGGCACCACAATACTTGTGTCATACCCGT
GAGCGCGCTGTCTTACGATAGTGCACGAAATAAGCTTTCGATTGAGCTTGAGTCTAGCCCGATACGACGTAAAATGAGAGAGAAAATCAACATCCTTGTC
AGCTCCATGGTATCGTCCAGATCGTGTTCGATTTGCCCGCTTTCGTCCGGATAGCAATAGCACTTCGATCTTCGATTCACCGTTGAATACTTTAATCAAG
ATAGAGTCAAATGTGCTCGTTCGAGGACCATAGTGAGAGTAAGTAAAAACGAGTTATGTACCTGTTAAGCTGGGTACACACGTGGTCTCCGTCGCAGGAT
CTTTCGCGCGTCCTGTATTAGTGGACACCACTCACACATTGCGAAGGGACCCACGTCTGTGGATAATCCTGTCGACGTTTTTCTACGTGCTTGTGCAATC
GATCCTGCAAGCGACTGGATCCCATTCGCGGTCGCGGGATGCCTCAGATAACAGATGTTGCATTATCAGAACCCTAGCTGCGACAATGATAGCTCGTGGG
TACATCACCTCCTCACAAAGCCCAGGCTTCATTCTACTTTTTGCCC