Description :
Non Conding Region
Location :
Scaffold_1:23496- 24497
Sequence
1001 bases(100 bases per row)
TACACGAAGTCCCTGTCTGCGGGAAGCCAGCCTTACAGTATTAACCTAAGTATGAATCGATGTTGCAGTGCGTTTGCTACAGTACAACCGTAAAGCCGTT
GCTTGGTCCCACTTGGCAGTGCTTGAGATTGGAGCCGCCGCGACCGCGTTGCGGTCTCCGTGACGGTGCGCGTTATACCGGGCCGGGTATAACGGCGGGC
ATGAAGTTGAGCTGTCCGACTTCCATGCTTCCGCCCTTGCAAAGCACACGACCCAACCTACCGATGCAGCTTTGAGCCGCGTAGCCGTAGAGCTTCATGG
CAGCCTTTAACGTGTGACAAACCCATTCGTTCGAGGTGCCTTTCCTGGCGTAGTCGCGTTGCAACTTGCAAAGAGCTTTTGGGTCCACGCATCCTCAACT
TTTGAAGCTCTAGGCCTTCATCAGGAAGGAAGCAAGCTCCTCCATCGCCTTGTGGTGCCGCGACAAGAACCCATCCTGCATTGCACTGCAGGAAGGGGAG
CGGAGAGTGTAACCGAGGCAAGCGATCCGATCCACACACCGGTTGAACCGGCTTCCGTGATTTGGGGTTTTCAGCATCTGAGACGCGCGAACGGATCGAT
CCTTCAATTGCACGAGCGCTGCCTCCGCCAAACAGCATATCGTGGGCCTTCCTTGTCTGCTCATGGACGCCACATCGATGCGCGGGCCATACAAAGCACT
GCCACTGCGCTGTTGCTGACGGACCCCAGAACGGAATATTCGAGCGTCCTCGCGAAAAAATCAAGCCGCTGCTCTGCTTCAGAGTGAGTTCGCTTCTCAG
GACGGTGATGGGGTCCACTCGTCCTGCCGTCAACACTTCCAGACTTGACTTGCCAGCGTTACACTTGCTCCCCGTGTTGGGTCGTGTCGTTCGCTCGGTC
CGCCGCCTTAGCGAGAGTTGGCTTAGACCTGCGCGACCGAACGACCGCTGCAAGGATCTTTTGCTCAGAGCTCGCTCATCGTTACTCTTCAATCGACGCC
A