Description :
Non Conding Region
Location :
Scaffold_1:23474- 23974
Sequence
500 bases(100 bases per row)
AAAGTGCGCTGAAGGAGTGTGTGGAGGTGATGATGGAGGAATGACCACAAGCCGTTTATGGTTTTGCTAGTGTTATTTAGTTTTTATTGTCTTGCTGATC
TCCTGCTCTGCTTGCAAGTGTGTTTTCCTATCTATTCGCCCCGGACCGACAAATAATGAAAGCTCAATCTTCGTCTGGAATGGGGACGGCTATCGCCTTC
GCGTTCAGTCTGGtagcgccgccgtcgctgtcgtcgcgaGCCTGGAGGCAAGTATACAAACGCACATGAGGcccgctcgctgctgcatcagaAAATCTGC
TGACGCTCACCAGTGTCGCCTCCCCTCCAAGCTTTGTCCTGGCTATCGAGAAGCACCCCCGCAAatcctcgctgctgctgctacctcTATTTTTTTTCTT
TTGTGGGGAACCATTTTCTCTTTTTTTCTTCATGGCATGCCATGATGTTCCTCTTTTCTTTTTTTGCCATACGCCACCATTGCCCCCGGCACAACCTCCT