Description :
Non Conding Region
Location :
scaffold_1:2289- 2594
Sequence
305 bases(100 bases per row)
GTGCCTTTGGATAGTGCAATTTTGCTTTTCCATCCCAAGGGAAGCTGCTAGCCGGTCAACGCGACCGCGTCGCCCCATGGGCAGGGCGTTGTGCAAACTA
AGTATGAAGCAGTCAGTATAATATCAATCCGATCAGCACACATGGCTAATCAATCGTGTTTCATCTTCGTTGTTTTGCTATTTTGTTAGTCACCTGACGC
AGCACGCAAAGCATGCTCACCAAGCATCACGTCACTGGGTCTCATTTGCCTGTATACGCTTGGAGTTTGGCTGGACTCATCTCATGCTCCATCACATTCG
GATTC