Description :
Non Conding Region
Location :
Scaffold_1:22838- 23012
Sequence
174 bases(100 bases per row)
GGAAGAGGATTGAGCTGCAAGTTCTTTCAGTTGTTTGGAGAATCACCCGGGCCCAGCTGACGCACTTGGCGACTTGCCCGGCATCGGCTGCTTCTCCTAC
TTTGGTAAGGCGACACTATAAGTACAGCGTTCCCTGACCTCTATGCTTTCTGTTCTTGCTAGTTATTATGGAGT