Description :
Non Conding Region
Location :
Scaffold_1:22721- 23289
Sequence
568 bases(100 bases per row)
TTCTGGTGAGACGCTTGCAGATTTACTGACGAAGTCCCTACTCGCGCCAGGGATTGCTGAAATACGGGACATGTTCAACTTGAAGTTCATGCATAGTACG
GGCGAGGAGGAGTGTACAAATCTATAGGCCTCCAGGAGAGGTTATGATCAGATTTGTTTTTCAGAGATCAAGTGCGCCCGCAATATCCCACTACGGTGGA
GGATAAGATTCAAGTCTCTCTTGCGCGTGCATACTCTAGTAGGTTATCATCAACAAAAAAAATATTCTCACTTTTACTTCTACCTACTTCTCCTCGATTG
CAATCTCTGCTTTCGACACTTACTAATTAATGAAATCTGACGAGAAAATATACTTGTATTCATGCATTCGCAAATTTGTTGGCGATACACGCGCACGTTT
GTCGTGATTGATCTTAGCATTACGAAGCACTTGAAATGGCCTTGAAAACCGCTACAGTATTGCTTGCATCCTGACTCCCTCACGATGATTAAATACCAGG
ATATACCTTCTGGGCTCTATTATCGACAGCGTTACGTAAATGTGAATAAGAAATTCTCAATACGCCAT