Description :
Non Conding Region
Location :
Scaffold_1:22698- 23674
Sequence
976 bases(100 bases per row)
GTCACGAGACGGTGGGTGGAGAAAACGATAGCTTTATGGGCAGCAGTGGGAGAAAGCACGAATGGGAAGAGTGAGCAAGTCAAGCGCAGCACACTGTTGC
CATGGGGGGTTGCAGGGGGAATTTGGCGACGTTTCAGGACAGAATTATCCGTTTCACATCGAACCGGTCCGCAGCGACACATCATACTGAATTCAAACCA
AAGAGCCTAATGGGCGGTTTGAACTGCGGTCAGGTTCTGAGGTATTGATCACGCAGCGACGCTTCCGTTTATGGGCACGATTTTGCCGGCAGCGCCGCGT
CCCTAGTCGTGGAGCAATTTGATTGGGGTTCTTTACTTGCATCAACGGCATTGTGTGCCGCCTCTCAGATACTGCAAGCCTTGTCGCGCGTGGGCGGTTG
GCGTTGGTCTAGGTTGGGTTTGCGGTGAGATTGAATTGGTAGGATTATGGTTTTCGGAGCTGCTGAGAAGAAGCTTGGCTATGGTCCCAATGCGACACGA
GCTGGAGTCTGGGGGAACCCAGCGTTTTACACCAGTTACTAGAGCTAATAAGGCGTCCGTTCATATGCGGGGGCTGGTGAAGTTCATCATCACAGAGGAT
CACACAGACAGACATCATCAAAAGATACTTCTTGGACGACCTTATCCACTGAGATAAGATATTGTGATGAGCTCTCGGAGGTGATTACTCAGAACCAGAT
CTGATTCACAATGATGCCTGGCTTGATGTGCCGCAGTGAAATTCGGGGAGCCAGAATGGACTACGACGCCGAGCTCGAGACGATGATGCGCGAGAGCGAG
CTGAGGCGGGCGCGCGGACCGCTGGAGGGCGACGACGACGAAGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNG
TCCTCCTCAGCGTCGACCGCCGCGCCGCAGTCGCGTTGGCGACTCCGACTGGGCGCGGTCGTGTTTCTCGGGCAGG