Description :
Non Conding Region
Location :
Scaffold_1:22659- 22980
Sequence
321 bases(100 bases per row)
TTAAATGCCCGAAATCAATTCAGCTATACAAATTAGCTGGGCGTCGGCATAATTCTATTCTTGTGGGCGGAGAAGCGGGCCGCGGTGCATCTGGGTTTGT
CACACGCGACGTGGAGCCAATCATATCGCACGGGCCCGCCCCCTGCATCCGTAACGAGCCAATCATATCGCTCCAAATCTATTAGCTGGCCAATCCACAA
AGCCAGTCATCGGCCAGCGTGACCCGCCGGCGTCACGCCCAGCTCCGTGCCATCTCCGTGTCCCTTGCCAAGATTCGCGACAGGTCTCTGCACTGGCGGC
CAAGACACGACGAAAGAAGCT