Description :
Non Conding Region
Location :
scaffold_1:22652- 23861
Sequence
1209 bases(100 bases per row)
TCCGAGAGCCACAGCACAGCTATCACTTAGTTGTGAATATACTTGAAACTTAAAACTTTTCTAACTTCTCCATCACTTCTTCCCTCCGTTTCTCTTAATT
AGCCGATGTTCTTCTTCGTCAAAAAACCAACCACACTCTTTCGATCAATACCAACGCGAGGCAAGGCCTTTTCCGGCCAGTAGGTGTTGTGTTCACTGTT
GATGGATGCTCCAGGCGGAATTACGTACATATTGTACGGGCAATTCGGTGAGATGGTCAACGCAAGCGCCCGCGTGTTATGCTTCCGCTTATCCGAATAA
CGGACAAGTTGGCGTATGAACTTCCAGTGATCATATGCAGACTCCAACCGGAAAAATGCCATGGTCGATTGATGGAAATTGCGAACTTCGGTTTCCAGTT
TTCCCATCCCAACACATCCACGCTGTGTCACCACAATGTCTCTGGTATCTGGAAACTCCACTGGTGCCATCCCGTCCCGGGTGTGGCACCAGAAAGCATC
CACCGGAAATTCGTGAAAAGCCTGAGTATCGGATGGGTCTTGGATTCGAATAAGGCATGACCACGCAACGTGGTCCCTGGCCACCGATAATTCTTCGTCG
ATTGCTTTTTTGTCCTCTTCGTCAGTTGGCTTGGTGTCAAGACCGCAATCGATCAAATCAATGAAAAACTGGGCTGCCGTCCACTCCGCCAATTGACGAG
CATTATCTTCAGTCTTCCACGTAGCACGACACAGCACATGCTCGTCTACTCGAACAACACAGTGGACGCCAGTTGTTGAGCGAGGATCTCGACTAAAAGG
TGTGCGAGGCAGATCTTCCACTGAGGTTATAATCTGGTGTGGTTAGATAAATAGCAACAAGTTAGGGAAAACATGAAGAATCGGACAAAAAGAAAATGTT
GCAACGTACATTGGCGATGCCTGAAAGCTTGAGATATCGGAACGAATCGATAGGAGAATAGTGTCCCACCGACTTTGTATCCATAAAATGAAGCAGTTGC
GCCCACTTTGATCGGATCTTGTTCAGCAAGTTCAGCATACCATCAACCGCGGCATTACAGGCATCAGACTTCGTTTCATCTGAAGCTTTGTAGTGAATGA
CGTCATTAACATTCACATGAACTTCAATGATACCTTCTCGAAGACGATCCATGGTAATAGTAGCTGTAACGTTACCAACAATCTGTACGTGCGCAGCTCC
ACGATACTT