Description :
Non Conding Region
Location :
contig_1:22462- 22590
Sequence
128 bases(100 bases per row)
TGCCCCGCCTCACCGGCAAATTCTCTCCTGTCGCCGACTAAGATGAAGTGGTTAGTGGATCGTATATCTTCTCAATATGATCCCCACGGCTTCTCCCTTC
GTTGTTTTTCTTCATCATTTTCTTGCTT