Description :
Non Conding Region
Location :
Scaffold_1:22315- 22388
Sequence
73 bases(100 bases per row)
GGAGACCAAGATCTTAACGTTGCGCGGTGGAGTATCGTCTGGTGATGTCAAGATTGAAAGCTGGAGCCAAGTA