Description :
Non Conding Region
Location :
Scaffold_1:22275- 25957
Sequence
3682 bases(100 bases per row)
TGCGTTGTTTGTGCCAGTTTTGAGCAAATATTTTCACTCTGACGATCGTTTTGGCGACCTAGGTGGACTTCGtCTTGCACTCACCAGACCGTCCGAAGTC
ATCGCTTTGCTCAGCTCTGCTACACTAGTGACAGAGCCTCTTTGtGCGTGATGACGAGTATATATACCATCATAGAGAGAATTTCAaCCGAAACATACGA
GAACGACCTTTCGATTACTGCCATTTAGGTGGAGAAGAATACGATTTGGCCAGCCCATGAGTAAGGCTGCCAAAAGCGAGGGCCGCACTCGGCGGgAACG
CCAATCGCTGAAGGGCGACGCAAAACCTGCCGACGGTGCCGAGCCTCATGAAGACTCGACGCTCTTGACACCACCACCAGCAACTGTGGGTGTGCTTGCC
AATGCGGAACCAGCTGCAGCTTCATCCACGCCGCTTCTCGTCCGGCCTGACGATGCAAACACAACATCCTCGGATCGCGAGAGTCGGCAGAAGAAAGCAA
AGAAGAAAACAAAGGAGCGGCAAATACTTTCAAGACAAGCACTACGAGAGGCGGCAAACAGGCTCCAGCAAGAACATGTCGAGAGTTCAACTACAACAAC
TGCACAAAGGGCTATCTCGGCTGAGGGATGGTCACTGGGTCGCTGGCAGCCAATCACGATGATTAAGTGCTTCACAGGGAGCCTTCTCAACAACTGCCAT
TGTCTCAACTTCGGATCGCTCCGTCCGCTAACCAGTCCAACACAGCTACCGCACTTGTCAAAGGAAGCACAAGAGACTATACAATCGCTTGACCCAGTCT
CGAAGAAGAGCCACCTAGAGGTCTTtGTCCGCCACACAGACAACATGCCATTCAGCAGCACCAATCCGAGCACGAAGAGTATTGGTAGACCTTTCATTAT
CCTCCACCTTGTCGACATGTGTACTGGGATGCCAATACATCCCCCACAGGCTACGAGAGCTGCTGTTTtCAGCCCTcACCTCCTcAACGCTTTCGAGTGG
AACGCATCTCAGCTCTTCGCAGGGGTTCCGCTTGTGCAGATTCTGTCTCCGCAAGTGATCTTGTTGCTCGAGATTGTCGAACCGAGAAAGAAAAAGACAA
AATGGAGTGAGAGGAACGCTAAAGGACCTGATGGGACTCACGGTCAGACGCACAAGAAACTTGCGTGGTGCTTCTTCAAGCCAGTGAACGATCgCGGgCG
ACTTCGACTTCCGACAGTTAGCGCCTTGAGCGCTCAGGACAaGCCACTTCGTCTGCAGTTATTtGCTTGGCAGCCTGTGGGATGGTTCGATGAGCAACAA
GCTCGAAGACTCTTCAATTGGAATCCGGCTGGCAAGATTCCGAAGGTTCTCCTTCAGTATCAGAAaCGTGCACGAGTGAGACTGTCCTGCAGTCTACATG
TtGAAATTCGTCCGATAGCACCCACTAGCATGACACCAAGTGGgCCGAGTGAAGACCATGCTGAAGCCTCCTCCcTCGTACACGATCAAGgCACAGCCAC
AGGTGACAATCAGGAACCTCCAGTGTCGCTGGACGACAAATCCATAGAGGCAGCGGCGCCGGTAGCAACCCAACATTCCAAAGCTAGCGACGTGGACCCA
ACTAATACGCCGGTGGTGCACGTTCAAGACCCTTTGATACACTGTCAACGACAGCCGGgTGAGCCGTGCATCATCCCCAATCGTGTGCTGTACCGACTTC
CGACAGGCCGTCAGGGCTGCTCATGCcTCAGCTTCAGTCCGGATGGCCTCTTCCTAGCCGCTGCTGTACATCAGCCGCTATCGGCCTCCTCCTGGACAGA
CGAGTGGTCCATTCAGATCCACCAGGTCAACACCGGCTTACTATGGCAGAGCTGTCGTAGCCACCAGGGTATGATCTACTCGCTCGAATGGTCGCTGCTC
TTGGATGGACGGAAGGCGATCGTCTCAGCTTCCTCCGATGGATCTGCTGCTCTGTGGTTGCTACGAGAAGCGACGCAAGCGcTTCCCAGTGTCGTAGCTC
CTCATGAAGTTTGGCAACACGTCCcAACCCCTGTGTTCGTGTACTGCGCCATCTTCCACTCGCAGCAGCCGCAGCTCGTGCTCACAGGTGCATCTGATGG
CTACATTCGAGTCTGGAGCATCTCCATCTCTGGGCAGCAGTCGTCCACTCCGACAACCAAACACTTGGTCAGTTCTGCTGCCGTTCACAGCATCCGCATG
GACCCAAAGTCCGGACGAGTGCTGTGCGGCGACGCGAATGGCTGCATCACTGTGTGGGACACCCAGTTCATGTTGGTGAAGACTGTTCGCACGGGTCAAC
GCGGCATCGCGAGCCTACAACTCCACCCTCGGAAGCAGCACTTGCTCGTACTCACGCATCCACACGCACTACTGCACTACGAGCTACGCAGCTTCCTGCT
GCTACACAAGAACTACACGGGCGTGGCATGTGACCAGCTCCTCGTCAAGGCCTGCTTCTCACCCGACGGTCAGTACGTCGTAAGTGGCGCCGAGGACGGC
GTGCCGCACATGTTCATGAGCGTGCAGGGCCACCGTGCGGTACCCGAGTCGAGCATTTGGGGACGGCGATTTTTCCATGGGCATCCATTGTTGGACGTGG
CATGGAGTCCAACAAGCCACATTGTGGCTCTGGGTGGATACGGCGGTGGCCATCCTGTGGTCGTGCTGTGTGCTCATCATGGCGATGCAGATGTAGACTC
TGGACAGCACTTCAAGACGCTGGACGGGCGTCCAATCCGTAGTGGATCTGGCATCCAGAACCACCGGATTCCAGAGATCTCGCGCGAGAAGCAACTGTCT
TCCTTGAAGCTACCAGATGGAGAGATGCGATCGCTGCAGCAGCGAAAGCACCACCTGCAGGCCACAATCGCGCTAGAGCACGAGAGGGCGGTGGCCCGTC
GCGTCACGACGTAAGGCCCCATAGTATGAGCTCATGTTCAACGGATTCCAAGTCGTGTGTGACGCAGAACGAGGAACCCAGCACTAATCGCTGTCTCATG
TACACCAATGCACCAGAAGGTGAGCCAGAACAACACGCCAACGCCAGTTGGGgTCGCTCACTGCCGACCATCCAACCAGAGTACAGTACTACGTACCTTG
AGAGGCATGGTAATCTCTTCGTGCTGGTGCCCGTGGGTAATCACGGCACTGTAAAGGCCCAGCAGGAGCCTCATCCACAAAGCTTtGTCCTGCTCGCGGT
GTGGAAAACCATGGGTGAGGCCATCACTTCACTTGCCATGGTCACtGTCGGTCCACCTTCTCTGCTCCTGGATAATCGGGGCTCTGGACTCTGGACGTCA
GCTTCCAGAATGCCAGATCCACAGCCGTGAAGAGGAGGcGCCCCAGCTGGACAACGCACATCAGCAATTtCGGTTCGAGTGCCCAGTTCCAGTATCAAAA
CACGCTCGCAATCATTtGCTCCcACTAACCAGCACCGAAaCGGTCTACCTTGTTCTGGTACCTCTCTCACTATCGGgACCGCCAGCTGGCGTCCTGGAAT
CAGCACGGAGCAACAATTGAACGAAaGTCGGCGCCCACATGGACCGTCGGCATGGCTGCAGATGCTGGCGCGGATGACTGTTCCTCTGGAGCTGCGTGTA
TGTGGCAAAGGCGTGGACGCCTGGCCAGAGCAGGAGGAAGGCGGTCACTCAGTCCGCGATTTGCGCCCCTCTGTCTCCATCA