Description :
Non Conding Region
Location :
Scaffold_1:22203- 22722
Sequence
519 bases(100 bases per row)
GTCGCAGTGATTGATGAGGAGGACGCGGGGCTTTGAGTGATCCATCTCGGCTCAGTGCGCGGCGGCTCGTCATCGCTCGATGCAGCTGGAGTGGCCGTAG
CAGCCGCTGAAGTGCGNNNNNNNNNNNNNNNNNNNNNTGCTTCTTGCGTCACTTGCAGTCGCAAATGCAGCTCTAGCGCCGACACGAGCAGCACACGAGC
GCGCGAGCGTCACCCCAAGTGATGAGGATGTCACCATTCAATCAATCGATCGATGATGCTGCTTAATTGTGTCCAAGTTCGTCGGAGCATCACCAAGACA
TGTCCTTAAATAGTGTGTTTCGCCTCACATGACACGAAAATGAGGTGGCTTGCTGTGGCTCACACGATTTCCTTCTTTAGAATCGCAAGCAAAATCAACA
AACATCCCTGATTTAATGTGGATACGCTATATTAGGTCACCGTTCTTAATTCGATGCGATTTGAGCAGTTCGCGCGTGCAGCAATTTTCGCGGGAACAAT
TGAGCTGAGCTGATGGCGA