Description :
Non Conding Region
Location :
Scaffold_1:22109- 22156
Sequence
47 bases(100 bases per row)
TCAAAATGTACAGACGTCAACAATTGTACACACATTAAATAGCGACC