Description :
Non Conding Region
Location :
Scaffold_1:22088- 22738
Sequence
650 bases(100 bases per row)
CGAGTGTCGGTGGCAGTTTAACGATAGCCGATCCGATTCCGGCATCATTTTTTCGACAGAGTTTCAATCTAAACCTCGACGTGTGGCTGTTTTGTGTGTG
TACAAATCAAACTACAAATCAACATGATCCGATGAATTCTGCGAACCAAATGAAGTCATTCTGACAAAGTGAAAGGCAAGCAATCCTGCTCACTTTTTGC
AGTCTTGGATGTAAAAGCTTATACTCGGAAAGCCGCCGCTTTTCGCAAAACTTACCAATGTGATGGTAACTACTAGCAAAGGGTTTGTTGCATCAAATCT
TGCAAAGGCAGGAAGCTCACGATACGAAAATCATCATTTACGCTGCCGAGGGAGGCCCGGTGTACAGTATCGAGAGCGAGACTGGTCAGACGCCCTGTTG
CAGTCGATTTCATGACTTGGGTGAATACGAAGAGACACTATGCAGTACTTCAGTATTTTTGATGAAGCATCTTTCAACGAGCAGGAGCCCCATTCCTGAT
CAACCATGTACCAAGACTTGTATGTATTACCATGGATAATACTTAATGAAGACTGCAACGCTGAAGAAATTTGTCAATCCGTCAGATGGCAAAGCCTCAA
AGTCTATTTACTTGTTGTGCATGTAAAGAATCCCCATGAGCGCAACATCT