Description :
Non Conding Region
Location :
Scaffold_1:2172- 2789
Sequence
617 bases(100 bases per row)
TGAGTCTTTTATGGTGCGGACCCGCTGAAGTGATTGATACCACATCCGATTGGATTTTTTGAGTTGAAATTTAGTATTTGTTGATTGGCGGGAAGCTCCT
GTCAGCCGACTCAAATTTTACGGTGGCATTTCATGGATGACGCTGCAGAATGTTTGCTTCGAATCACTCACAACAGCGAAGGTCATGTGATCAACAAGCT
TTTGGAATGTCAATTCTCTTTCAAATAAAGCAATGTGAGATACTGGTAAATTGGCGAGGACTCTCGGAATTCGAATATTCTTGTGAGCCCGCTATCAATT
CATTTCAAGATGTGTTCTCATTAATTCCGTAGCTCATGTGATTGCGGCCCGAAAATGGTCCAATCACTATAGTGCAGGACACTTAAAACCAGCATGTTAT
TCCCCTACTAAAATTAATAATGTCGAATTGGATAAAGTATGTAAATCTAAAAAAAGAGCGCTACAGATCTCCCTCCATTAGGTCCCATCGCCAAAAATAC
ATACCCCCTTTAGCCCGATAGCCATGTATTTTACTTAATTTTATTTTCATCATTCTAATTCTCCCACGCATTTGTCCTCTGTCATCAAAAAGAGCAGGAT
GAGTACGCGTGCGCGCA