Description :
Non Conding Region
Location :
Scaffold_1:21468- 21630
Sequence
162 bases(100 bases per row)
AATTCTCTACTGACCGAAAAATGGGTCGGCGTGTGGGTGGACCTACCCCTACGGGTTGCCGCACGGCCCCGGCTGTGCGCGGGAGGGAGCCCACTCTCTG
GACCTCCGGTGCTGGATTTCAGCCAACCGCCGGTCGTAAAACTCTAGTTAGCCAATCAGAAC