Description :
Non Conding Region
Location :
Scaffold_1:2137- 2292
Sequence
155 bases(100 bases per row)
CGAGGCGAAGCTTTCGATTTGACCAACAGAACAAGAGTAACTGAGGAAATGACACATGCTCACTCAACTGAACCGATCCGCGGCGTTGTTGAGCGAGCCT
GTGTGTTTTATCTGGTATTTTCCTCTTTTGTTCTGTTAACGGGATGCAGCGTTTC