Description :
Non Conding Region
Location :
Scaffold_1:21319- 21574
Sequence
255 bases(100 bases per row)
GTCACGCCAGCAGTCAGCAGATTGACCCAAGCTCGAGGCTTTCAGCTACAGAGCCTTCACCAGGAAAAAGCAAATGCGTCGTGGCTCGTGCACGAAGAGG
CGGGTTGCATTGGTCAACGAGAAACTACTACCGGCGGGTAGCTGAATGGTCGGTGTGGTCTTGGACTCAAAACGAACTACAAATGCAATTCTCATTCATT
AAGCACGACGGCAACGATCTCAACATGCAGACAAGAAGACTCGCAAACGTTACCT