Description :
Non Conding Region
Location :
Scaffold_1:21220- 21549
Sequence
329 bases(100 bases per row)
GGTCGTGTATGATTGGTGCAAAACTTGATGCCGTTTGATTGGCTCGCAAATGTTTGAAATCCAGTGATTTTCGGCCAATCCGACTATGCGCTGGAAGATC
GCCACACAGAATCCATGGGTCCGTACGGTACACGTCCACAGATCGAGTGCAAGCCGCTTCAAGACGAGACGACTCAAGTGCTTGGGAAGGCGAACAAGGC
GCATGGAGGTCGAATGCTTTGCGGGGGTTGAGCGCGAGGGTTGCTCAAAGAACACGAGAAGGTTGCACCCAACCAGGTCGAGCCACATCTCGCTTGAAGT
AGCTTGCAGCATGATAGATACACTGACGC