Description :
Non Conding Region
Location :
scaffold_1:21057- 23286
Sequence
2229 bases(100 bases per row)
CTGCCGCCAGAGTTGGCCCTCTGGAAGCGGTTCTGGCGGTCGCGATTCATCGTCTACCAAGGAGTCTCGTGTCCTTGTGATAGCGAAGAAATCGAAGTGG
CGAATCCAGGCGGTCACGACGATGCGGTCTGTAGAAACTCAAGCTTGACTGGCCTCTAGAAACGCGCTGACCGAGAAATCAGGCAGGTGGCACTGCCGAT
GGCGTTGCGATCGCAAATGGCGAAGTGGCGCGTTGGCAACGAGGCCATGTTTGCTCCACCTGGTCGGTGCCGCGCCCCGCCGATGACACGTCAGTAAAGT
GACTACTTAAGGTTTGTATGCCTCCGGCCCTTCTCTGGCTCTTTTCGCACAATCCTGGCGCGGGCTCGGGGATATCGTTTTCGGCTAGCCGCCACCTGTT
CAGGAAGCACAAGCGCGTTGCACTTTCCCGCTGAAGTGAAGTCCGCTCCTTCGGCGCTAATAGACATTTTGTGTCGCTGTTCAGTTCAAGTATCTGGCAT
GGAGCTCGTCCGTTTGCTGCGGATTATCGGCCAGCACCACCAGCAGCAGTCCGGCTGATTGGATGCGTTTCAATTTCGAAGCGAGCTGTGGCGCGAAGCC
TCTCGTTTCTCCGAACACAACAGATTCATTGGCGCTGCTCCGCGCAGCGATGGCTTCGAATACATGTCCAGCCGACCAGATTTCCAGGTCTTGTACCTGT
ACGCAAACCGGGACGGCATCATGTCAATCGTTTGCCAGGCATTCCGTTGGTTCACGCCGCTCATGGTGACATCATAAATTGTGTTTTCACAATTTCTTCA
TAAGCCTAAAGCCTGCCATGACCACATGAAAATATTAAAGGGAGTCAGCATCCGATTTCCTCAGTTCAATGCGGTTGGATCAAGGATCCAAGAAATCGCC
AGCAGTGCGAATTCAATTCTGATAGACGTTTCAACAATCAGGTATATTTCTGGTCCACCATGAACGATCGATATCCTCCACCACTCCCTCATACATGTAG
CAACAACTGTGGTCGTTGTCGTCGCATGCAATTTGGTGTTGACGAGAGGATAGACTCGTCACTAGCGACACTACGTCATGTAGTACATATGCCAGTGAGC
CATAGGTATTTAGTGTCACATTGAATTGAATGGCGACTCGAAAGTTATAAGGTTGCAAATTGCAGCGAAACGGGGAGATCGTCGGAAGCATTGCGGTGCA
CAAACACAACTCGCGCTTGATCGTGAACGCGACCGCCGGTAATGCGTTGCCAACCCAAGTTGGTCGAGCCCGAGATTCTCTTGCGATGTGTTGCCCGCGG
GTTTTAAGCAAGCCGGCCACAGGGACAGCCTCTCCAAAGGAGACTCCTTTAGCTACAGTACGTAAGACATGGCTAGGGGACGACTGGTGGCCCTGTGGGT
TGGACCCACGAAGTTTAAGTTTAAGCGTACCACTGAGGGTTCGAATCGCCCGGAGCAACACTGATACAAATTTCAAGTCATCCCCTTCCAACCTCTCGAT
TACCTCTCACACTTAATCTCCTTCCTAAAATGGAACCCCAATAACCTCTGAAAATTACATCCCATTCAAACCAGCAGCCAAGAACCTCAGGAAGGCAAAC
ATCCAGAAATAGTTTAGGGTAATTCACTTAGACGGCAATGTGCCAGCTACTAGCAGGCTTCGAAATAAGTGCCTAAATATACGCCACCTGGTCAGGTAGC
AGGGGCCTTCTCTCTCTCTCTAAAGACATGCCAAGCTCGTGAAATCGTTGAGCGTATTAAAGTATTTGGTATCGCCCTCATGATCCCATCCCGGCGTAAC
CACAGCATCATATTTAACATTTTCAAGCAGTTGGAGCCTCGTTCACTTGCAATCTAACGTCATGCGCGACTGTAGCGCTCTCTGCGCAGAATGGATCTTT
TCTCTTCGACGCAACGTACGCCGCTGGAGAGCCCGCAAGGTGTACATCACGGTGAGTGAAGAGGTCACTCTTCAACTGAAAAGGCAACTCCACCAGCAAC
ATGTTTTTCGGGAACTCGACGACTGAGACCAGCCAAATGCAACATATAGGTTATCGACAGGGGGCTTTAAAGTCTGTCACGACCATATTCTATCATTTTA
TATTCGTTCATTAAAGCAGGGTATCTATTCTAATAGGTTCCGTTTTAGCTATTTCTTCCCACCTTTTGCCCTCCTCTCTCATGGTCGACCCCCTCTGCTC
CGCAGTCGACGCCCTCTTGACGCGCCCCA