Description :
Non Conding Region
Location :
Scaffold_1:20983- 21031
Sequence
48 bases(100 bases per row)
GCTCTGTTGATGAGTAGCTAGCAATCACCTTTCGTAGTACATCCACTC